Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YM15FM1
Length(NT) : 603
Best Gene Model Blast : Link to GSTUMT00010936001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: fungal specific transcription factor, putative
Accession: ref|XP_001262274.1| Score: 148 E_value: 3e-08
KEGG Definition: predicted protein
Accession: aor:AO090003000967 Score: 145 E_value: 4e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB26YM15FM1
TTGGGGAAAGCCTTGCTGTCTTTGTACCATCCATTAAGACACTTTAAAGA
TGGCTCGCTGTTAAGCCAGGGGAAAAAGGACAAACTGTTCCGGACAGCGG
TGGAAGCTTTAGAGTGCTCCACATCCCTTGTACGAGATCCTGACGTTGTA
CGGTACGAGCAATGGAATTGGCTCTCCCAAAAATACAACCATGCACAAGC
AGCTAGTCTCGTATTATCCGAGCTTGTAGTGAGGCCACCGTTTGGCACAG
ATATGTTGGAGAGGGCGTGGGTGGCGGTGGACTTGCTCTTGGGTACCGAA
CCTTGGAGTCGGGAGAACCCCATCATGGCGGAGAGAGTGTGGAAGCCATT
GGGCAAACTCAGGGATAAGGCGCTCGCTAGGAGAAGGAGAGCGCTACAGG
AGACGGGAATGGCGCAGAGGCAGAAGCCAAGCGCATCGCTGTCGATAGGA
GAAAGTGATATTTGGGAAGGAATAGTCGTTGAGGATGTGCCCATAGATTG
GGGAGAATGGGACGAAATGTTTCAATACATCGATGAACATTGAGTAGAAA
CGCTTCATCAGGGAGACAGACTTTAAGCTTGGTGGTAGACGCAGGATGGA
TAA

Sequences in the Contig:

SY0AAB26YM15FM1