Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YL19FM1
Length(NT) : 696
Best Gene Model Blast : Link to GSTUMT00011664001 E-value : 1e-137
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57212.1| Score: 295 E_value: 2e-48
KEGG Definition: HAT repeat protein
Accession: aor:AO090001000722 Score: 295 E_value: 1e-48
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0495 Score: 337 E_value: 1e-32
PFAM Definition: PRP1_N, PRP1 splicing factor, N-terminal. This domain is specific to the N-terminal part of the prp1 splicing factor, which is involved in mRNA splicing (and possibly also poly(A)+ RNA nuclear export and cell cycle progression). This domain is specific to the N terminus of the RNA splicing factor encoded by prp1. It is involved in mRNA splicing and possibly also poly(A)and RNA nuclear export and cell cycle progression..
Pfam Number: pfam06424 Score: 302 E_value: 2e-28
Swissprot: Q12381|PRP1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0000398 = Biological process: nuclear mRNA splicing, via spliceosome

Sequence:
>SY0AAB26YL19FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTCTTCGTAGTATCAACTGA
ACGAAAACCCCCGAGATGATGAAACGTAACTTCCTCGATGAGCCAGCACC
GGCAAACTACGTCGCTGGTCTCGGTCGCGGTGCTACTGGATTCACAACAC
GATCTGATATTGGTCCCGCACGTGAAGGCCCTTCAGAAGAAGCTATCAAG
GCCGCCCTCGCGCGAAGAGCTGAAGCGTTAGGACAGGCCCCACCGACTGC
CTATGGTGCGGATAAGAAGAAAGACGATGATGACGATGACGACGATCGAT
TTCAAGACCCCGAGAATGAAGTTGGACTTTTCGCTGGAGGAGCATACGAC
GAAGACGATGACGAGGCAGATAGGATATATCAAAGTGTAGATGAGAAGAT
GGAAAAAAGGCGAAAGTCACGAAGTTTTGCCGACTCCTTCGTCATCATAT
AGGGAAGCACGTGAGAAAGCCGAGCGCGAAGAATACGAGCGTAAGAATCC
AAAAATTCAGCACCAATTCGCTGATTTGAAGAGAGGACTGGAAACCCTCA
CCGACGACGATTGGGCGAGCTTACCAGAAGTGGGGGATCTTACGGGGAGG
AATAGAAGGGCGAGACAAGCCATGCGACAAAAGTTTTACCCGACCCCGGA
TTCGGTGTTGGTCAATGCTGCCGGCTCACAGTTCGAGACTTCTGTC

Sequences in the Contig:

SY0AAB26YL19FM1