Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YJ09FM1
Length(NT) : 647
Best Gene Model Blast : Link to GSTUMT00002372001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU03924
Accession: ref|XP_957563.2| Score: 482 E_value: 7e-47
KEGG Definition: hypothetical protein ( (AL356172) conserved hypothetical protein [Neurospora crassa OR74A] )
Accession: ncr:NCU03924.1 Score: 482 E_value: 3e-47
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q10337|BRC1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0051276 = Biological process: chromosome organization and biogenesis
GO:0000018 = Biological process: regulation of DNA recombination

Sequence:
>SY0AAB26YJ09FM1
TTGGGGCAATCTGCGGAGGGATAATTGCTATGGGTGGGCAGTATGGCAGC
AACTTGACAAAGTTTACAACTCACATAGTCGCATTGAATATGGACAATGA
GAAATGCAGACAAGCTGTAGCTAAGAGGATGTCGATTAAAATTGTTTTAC
CGCATTGGTTCGATGATTGTCTTAAGCTCGGGCGTCGCATTGATGAAGCA
CCCTATCTCCTCCCGAATCCTGAAATTGAACGAGTTGCCAACTTTGAACC
AATGCCCCTACCAAAAGGCCCCGACCTGACCTATAGCCATGCTCATGACG
GGGGGGCAATGGCTCTTGACCCTCCATCTCCGAAGCGCAGCTCGTCGGTG
TTTGAACGCAAGAAGATTCGATTGGGCGAAGACTTGGAATTGAGCCCGAG
GCTGAAGTCAGTTATAGCTACTGTTATTGTTCAAATGAAGGGCGAGGTTG
TGGACAAAGTGGAGGATGCCGATATATATGTTGGCCAGTTCCGAGGTGGA
GAGGAATATCTAGAAGCGAGCCATGTAGGCATCCATGTAGGCAGCCTAAC
TTGGCTGTATTGGATTTGTGCGCATGGAAGATGGACTTCTCCTCTGGCCA
AGTTGCTTCACTATCCACTCGTTAGAGGCGGGCTGCCCGGGATGGAG

Sequences in the Contig:

SY0AAB26YJ09FM1