Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YJ01FM1
Length(NT) : 550
Best Gene Model Blast : Link to GSTUMT00003073001 E-value : 3e-91
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_06567
Accession: ref|XP_001222662.1| Score: 147 E_value: 3e-08
KEGG Definition: hypothetical protein
Accession: ang:An11g10080 Score: 130 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB26YJ01FM1
TTGGCGTCACCTGGGCTAATTGTTATCATGGCCAGGCTTATATATTACAC
TCCTCCGGCGACCATGGTTCGTCTATTCTCCATTAGTGCCATAAACGCCT
ACCTCACGTCGTGGGCTTTGACTATCGTTGGAGCTGGAAAGCCACGAATG
CTCCTACCTGCATGGATACTGATAGCGCTTGTGAGCTTCCTCTGACTCTC
ATGCAATGATTGATTTATCATACCCTATTTACTCGATACACGACGAAAAG
GTACTCGCGGCCATACATCGGATGACCGTCCGAAAGATCAACCTTTCCCA
TCAAGTGGCTTCTGCCACAAGTGTGCTGTGCTTTGCCGGTGTTTGCAGCA
CTCTTGCCCTGCTATTGGAGTTGCACCTCTGCCCACTCACCAGACCAGAA
TAGACCAGATCTATTGTGACCCTTTGGATATCATACCTTCTCCCGCCCGC
CTTTTTACCCCTCTGCCTCTTTTCTCCCCCTCCCTTCATCATTTCCTCAT
TCCTGCTCCCTCTCTCTCTCCTACTCACTCGTTTGTCGGAGGGTTCTGCA

Sequences in the Contig:

SY0AAB26YJ01FM1