Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YG04FM1
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00003265001 E-value : 1e-152
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06688
Accession: ref|XP_001592447.1| Score: 260 E_value: 4e-21
KEGG Definition: hypothetical protein
Accession: ncr:NCU02704.1 Score: 236 E_value: 1e-18
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0558 Score: 242 E_value: 1e-21
PFAM Definition: Biotin_lipoyl, Biotin-requiring enzyme. This family covers two Prosite entries, the conserved lysine residue binds biotin in one group and lipoic acid in the other. Note that the HMM does not currently recognise the Glycine cleavage system H proteins..
Pfam Number: pfam00364 Score: 122 E_value: 1e-07
Swissprot: P11182|ODB2_HUMAN
Gene Ontology:
GO:0005947 = Cellular component: mitochondrial alpha-ketoglutarate dehydrogenase complex

Sequence:
>SY0AAB26YG04FM1
TTGGCTATCAAGGGGTACTGTATCAGTGGGGAGTGACTCTACCTGTGCGG
TTGCGGTAAACTTTGCTGGTAAGCTCCAACCCAGTGCAGTACCGGTACCG
TGCTTTACTCGAGTAGAGTCCAACCGGGGAAGAATTCAACTCCTCGCCTT
CCCCGCAAAAAAAGCCCCCCAATCACACACACCTTACACGGCTATCGACG
GCTCAGTCAACAGCATCCACTGTGGCCCGTCCCGTCTCGGATATAGACCA
CAAGTACTCGTACCCGACCCGCAACGCGCATATACCATACATACTCGAGT
ACGGAGGAGCAGAAGATGCTGTGGGGCAGTACCGGCAGTCGAACGGTTGT
GCGAGCTAGATTTTTCCGGAGGAGTAACAGCAGCAGCAGCAGCGTCAGAG
TCCTCCCTCCATTTATTACTACCACTGCAAGATCGTCGTTGTTGTCTGTA
TCGAAGTTGTCGAGGTCAAGGGGGCTCAAGAGTTCTGCTCGGGTGCTTGT
CGTGAAACCATTCTTACTCGCGGATATTGGTGAAGGAATCCGTGAATGCG
AAGTCATACAATGGTTCGTTCAGCCAGAGGCTAGAGTGGAGCAGTTTGAT
AAGCTTTGTGAGGTTCAGTCTGATAAAGCTTCTGTTGAGATCACTTCACG
CTACGATGGGGTCATC

Sequences in the Contig:

SY0AAB26YG04FM1