Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YG02FM1
Length(NT) : 682
Best Gene Model Blast : Link to GSTUMT00005618001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03750
Accession: ref|XP_001244309.1| Score: 550 E_value: 1e-54
KEGG Definition: hypothetical protein
Accession: ang:An02g06350 Score: 525 E_value: 4e-52
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0204 Score: 515 E_value: 3e-53
PFAM Definition: Cation_ATPase_C, Cation transporting ATPase, C-terminus. Members of this families are involved in Na+/K+, H+/K+, Ca++ and Mg++ transport..
Pfam Number: pfam00689 Score: 249 E_value: 2e-22
Swissprot: P38929|ATC2_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology
GO:0005388 = Molecular function: calcium-transporting ATPase activity
GO:0006816 = Biological process: calcium ion transport
GO:0006874 = Biological process: cellular calcium ion homeostasis

Sequence:
>SY0AAB26YG02FM1
TTGGGCTGCTTTGGCCCTCGCCACCGACGCTCCTACTCCCCAGATCCTGA
ACCGCAAGCCGACTCCCAAGTCCGCCGGTCTCATCTCGTTGAATATGTGG
AAGATGATTATCGGACAGGCAATCTTCCAACTCCTCGTCACTTACACCCT
CTACTTTGGCGGCATGACGATCCTTGGCTATTCTACTGAGAATGACGTTT
CATTGAAGGCCGCAGGAAAAGCCACCCCAAGGGACGAGTTGAACACAATG
GTCTTTAACACGTTCGTGTGGATGCAGATCTTCAACGAGTTCAACAACCG
GCGCCTAGACAACAAGTTCAACATCTTCGAGAATGTGCATAAGAACTACT
TTTTCATCGTCATCAACGCAATCATGATCGGCGGCCAAGTCCTTATCATT
TTCGTCGGTGGAAAGGCCTTCTCCATAGTTCCCATCAACGGCGTCCAATG
GGCCATCTGTGTAATCGTCGCTTCCTTTGCCCTCCCTTGGGCAGTCATTG
TCCGCTGTGTGCCAGACGAATTCGTCCGCAAGCACTGGTGCAACTTAGTG
CGCGTGTTATCCCCGCCGGTTAGAGCCGTTGTGAAGGTCATCCCAAAGAG
GAATAAGAGGGCTGATTACCAGAGCGATAAGGAGAAAGGCAAGGCTGGTG
AAGCTAAGCCTTGAAGGGGAGGTGGATGATAG

Sequences in the Contig:

SY0AAB26YG02FM1