Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YD22FM1
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00012229001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: aromatic ring-opening dioxygenase LigB subunit, putative
Accession: ref|XP_001257486.1| Score: 554 E_value: 3e-55
KEGG Definition: uncharacterized conserved protein
Accession: aor:AO090026000787 Score: 548 E_value: 8e-55
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2133 Score: 106 E_value: 7e-06
PFAM Definition: LigB, Catalytic LigB subunit of aromatic ring-opening dioxygenase..
Pfam Number: pfam02900 Score: 262 E_value: 6e-24
Swissprot: Q949R4|DIOXL_ARATH

Sequence:
>SY0AAB26YD22FM1
TTGGATTATCATACTTACTACTCCGGTCGATATCATATACTCTACTCGTT
ATGGCAACACGACCAAACCTGGCGCAACGCACTCTGCGAAAGATCTCTAG
AGCCACTTCATCTTGTGCTACTAGAAAAGATACCATGGCTGCCCCTGCAT
CCGCAACCACCGCTGCTACGGGGCGTACACCCGTATACTTTGTTTCTCAC
GGAGGTCCCAACATAATGTACGAAGTCGAGCACCCAGCCTTCCACCAATT
TCAAAAGATTGGGAAGGAAATCACTACAAAGGTCAAACCGAAGGCTGTCG
TGGTTTTCTCGGCCCATTGGCAAGCGGCGGCGGCAGCGGGGAGCAAGGTT
GAGGTCAATACCGCGGAGTTCATAGATTTGGTATACGATTTCCATGGCTT
TCCGGATCATTACTACAAGCAAAAGTATCCGAACGTGGGGTCTCAGGAGC
TTGCAGAGAAGGTTTTGGGGTTGCTTAAGGAGGCCGGAATTGAGAGTGGG
GGGGTGAAGCGGGGGCTTGATCATGGGGTTTTTGCTCCGTTTACCTGTAG
TATGTATATGTTTGGACCGGAGGAGAATCCGCTGGGAGTTCCTTTGGTGC
AGGTTTCGTTGTTTGGTCAGGAGGATCCTAATATGCATTATGCCCTCG

Sequences in the Contig:

SY0AAB26YD22FM1