Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YB15FM1
Length(NT) : 696
Best Gene Model Blast : Link to GSTUMT00010427001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_01879
Accession: ref|XP_001559723.1| Score: 843 E_value: 1e-88
KEGG Definition: hypothetical protein
Accession: fgr:FG00865.1 Score: 833 E_value: 8e-88
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2697 Score: 973 E_value: 1e-106
PFAM Definition: Histidinol_dh, Histidinol dehydrogenase..
Pfam Number: pfam00815 Score: 950 E_value: 1e-103
Swissprot: P07685|HIS2_NEUCR

Sequence:
>SY0AAB26YB15FM1
TTGGGCCAGGAGTCAGGTGTTCCCGTTTTGTCCGTCCTATTGAGCGTGTG
GGTCTTTACATCCCAGGAGGCACAGCTGTGCTTCCTTCTACAGCATTGAT
GCTCGGTGTTCCGGCGCTGGTCGCAGGTTGCAAGAAGATAATTTTCACAT
CACCGCCAAGAAAAGATGGAAGTTTGACTCCGGAAATCGTCTATGTGGCC
CACAAGGTTGGTGCAGAAGCTATCGTCCTTGCAGGGGGTGCTCAGGCCGT
GGCAGCGCTCGCGTACGGAACAGAAACAGTTCCCAAAGTCGACAAGATCC
TCGGCCCCGGTAACCAATTTGTTACTGCTGGGAAGATGTTTGTGAGCAAC
GACACGGGTGCAGGTGTCAGTATTGACATGCCTGCCGGACCATCCGAGGT
CCTTGTCGTTGCAGACGCAGAGGCCAACCCGGCATTCGTCGCTTCAGATC
TACTCTCGCAAGCTGAGCACGGTGTTGATTCCCAGGTTATCCTGATAACC
GTCGGGTTAACCGAGGAACAGCTTGTCGCTATCGAGGAAGAATTGGAAAA
GCAAGCTCTAGCACTCCCTAGGGTAGACATTGTTCGCGGCTCAATTAGCC
ACTCAGTCACTCTTCAAACAGATAATATCGAGGAGGCGATTGAACTTAGC
AATCAATATGCTCCTGAGCACCTGATTCTCCAGATCAAGGATGCTG

Sequences in the Contig:

SY0AAB26YB15FM1