Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB26YA21FM1
Length(NT) : 200
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4676 Score: 145 E_value: 7e-11
PFAM Definition: DUF1777, Protein of unknown function (DUF1777). This is a family of eukaryotic proteins of unknown function. Some of the proteins in this family are putative nucleic acid binding proteins..
Pfam Number: pfam08648 Score: 149 E_value: 2e-11

Sequence:
>SY0AAB26YA21FM1
TTGGCAGGGACAGAGACAGAGAAAGGGACCGAGATAGGGACCGAGACAGA
GACAGAGACAGAGGCCGTGACCGAGACAGGGACCGCGACAGGGATCGCGA
ACGAGACAGAGATAGGGAGCGAAACCTCACCCACAACCTCCCACGAGACT
ATGACCGCTACGTCCCCCGTCGCGCGACCGCATCCCCCCCAAACCTCCCT

Sequences in the Contig:

SY0AAB26YA21FM1