Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YO17FM1
Length(NT) : 659
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: ankyrin repeat domain protein
Accession: ref|XP_001273619.1| Score: 181 E_value: 6e-12
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 173 E_value: 2e-11
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 119 E_value: 3e-07
PFAM Definition: No Hit Found
Swissprot: Q8ZWC4|Y1861_PYRAE

Sequence:
>SY0AAB25YO17FM1
TTGGCTGGAACGGGCCGATGTTGATCCCAACAAACAAGATAACTATGGCC
AAACACCACTTTGTTACGCTGCTAAGCGTGGGGCCGCGGGAGTGGTGAAA
ACGCTACTCGGACGGAAAGACACCAACCCCGACATGCCTGACCAATTAGG
CCGAACACCGCTCTGGTGGGCCACTGAGTATGGCCATGTGGGAGTGGTGG
CGCTACTACAATCTCGAGCATCTGCCACCCTCAGCACAGCCTAAGGCCAA
CGAGGCATTGCTTCTCCTTACGGTACTCGAGTTCTAGTACGGGTGACCCA
TGTGCCATGGTCCGCAAAGACTACAACAGCTCCACCAGCATTTCTGCTGG
CCGCCGTTGCCTCCTCTTCTCACCCCGGTCTCCTCCATAGTTCAAATGTC
ACGTTCTGGCCGAAGGAAATCTTACGCTGTGGGGATGCACATATCTATTA
CATCGTACCCAAATCACTCTACGAAGCTTAGTATTGTTGAGTCAGGATCT
GTTAACATCTGTTTATAATGTAGAGTTTGGCGTTTGTGGGAGGCTATTTC
CCATATATTAGGATAAGTTTGTGTGGCTTGAAATTTTCCCTGTTATTTAC
CGTATCATACTTTTATTGTATTCTGGTTGTAAATCCTCTTTGCACATTGA
ATTTTTCTA

Sequences in the Contig:

SY0AAB25YO17FM1