Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YO01FM1
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00004267001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08063
Accession: ref|XP_001240900.1| Score: 479 E_value: 1e-46
KEGG Definition: small nucleolar ribonucleoprotein complex subunit, putative
Accession: afm:AFUA_2G03930 Score: 460 E_value: 1e-44
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2048 Score: 348 E_value: 6e-34
PFAM Definition: No Hit Found
Swissprot: Q06679|UTP4_YEAST
Gene Ontology:
GO:0032040 = Cellular component: small subunit processome
GO:0005515 = Molecular function: protein binding
GO:0000462 = Biological process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Sequence:
>SY0AAB25YO01FM1
TTGGACAGCTCTAGCCTTCTCTCACCAATCTACGCCTGCGTCACCGCATC
CTCCGCCCAAGAATCTACGATTAGCAATTGGTCGCGCGAATGGATCCATC
GAGATCTGGAATCCCCTTTTAGGTGCCTGGGTCTATGAGAGCACTCTTGC
GGGCGGAAAAGACCGCTCAATAGAAGACCTCACATGGGTTCAGGATTATG
ATTCCCATGGAAGAGGTCTCCTCCGCCTCTTCAGCATTGGGTATTCCTCC
GTCGTTACAGAATGGGACCTGGTAACCGGCCGCCCGCGCACGCATACGGA
CTGCAATGGCGGCGTGATCTGGAGTATCGCTGCTCAGCCACGGCTTCATT
CTTCCGATAAGGTCGACCAAGAGAACCAGGAGGCCTGTTCACAGAAGATT
GTCGTGGGCATGCAGGATGGGGCACTGACAATTCTCTCGACCGCCGGTGG
AAAAGGCGCGTTAAGTTACGTCAAGACACTGATGAGGGCCGGAACTGGTA
AATCCAGGGTTTTGTCCATGGCCTGGCAGAATAGACATACGGTGGCTGCT
GGGATGGCTGACTCGACAATTAGAGTGTGGGATATTCGCTCCGGTCGAGT
AGTTTCCAGGTTGTCGCTGA

Sequences in the Contig:

SY0AAB25YO01FM1