Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YK03FM1
Length(NT) : 583
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 146 E_value: 1e-10
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 121 E_value: 1e-07

Sequence:
>SY0AAB25YK03FM1
AAGCCGGTTCTCACCCTTCAAAAACCGATCCTCAGCCTCCGAAAGCGGGT
TCTCGCCCTCCGAAAGCGGGCCCCCACCCCCCGAAGGTCGATCCCGACCG
TACGAAAGTCGATTCACGCCGCCGGAGGGCACCAAGCAAATAAATAATAA
GGCATCCCGGCAACGACGGACGCTAGTATCTCGAAATTTCTCCTATGCGC
CACCTAAACCAGATCCCCCACAATCATTACCACAATCACCACCGCCGTCA
CGAACGCCGTCACCACCACCACCACCATATAAGCGGACGCCATCTCCTCC
ACCTCCAAAGGAATACCAACAACCAACAACCAAACCCAGAGCCCCACGTA
GAAAGCCTCGCAAAGTAGCATTAGCCTCAGGGTCAGAGGCGGAAAAAATT
CCGGTCGATGTAGAGAAAAAGCAAGATGGCGATTTGGGGGTCTGTATCAT
ATTCATGGCACTATTCTGGTTGCTTTTCAGTTTTATATGTAGGCTAGTTC
GCTTGCTCTGGCGGCTTGTTAGATTCGTTGCTGGGATATGAGAGTTGATC
AGGTTATCTATTTCACAAAATTTTCGTACTTTC

Sequences in the Contig:

SY0AAB25YK03FM1