Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YI14FM1
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00005001001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: MFS drug efflux transporter
Accession: ref|XP_754099.1| Score: 378 E_value: 8e-35
KEGG Definition: MFS drug efflux transporter, putative
Accession: afm:AFUA_3G15250 Score: 378 E_value: 4e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 189 E_value: 2e-15
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 178 E_value: 4e-14
Swissprot: Q00357|TOXA_COCCA
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane
GO:0019534 = Molecular function: toxin transporter activity
GO:0006810 = Biological process: transport

Sequence:
>SY0AAB25YI14FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGACTTTGGTTATCATAAAG
AAAGAACGAAAGAGCGCAAGTCATCAACAATGAGCCTACCATCAACGACG
CCCTCACCCGGGCCAGAGTTCAATGAGAAGAGCCTTGGGGTACCTGAGCG
GGACGTGGAGAGGGGACCTTCGGCCGCTACGTCTAGTACTGGTGATTTGG
TATTGGGGGATAAGTCGGCTGAAGAGGTCCCTCCGCGAACCGTCAAGGGG
GTATTATGGGTCCTCGTCGTGATATCAATCCTCTCTTCCACATTTCTGTT
TGCTCTTGACAACACAGTTGTTGCCGATATCCAAGCATCGGTAATTACCG
ACTTTGGCGAGATTGAGAAGCTGAGTTGGCTCGGAATTGCATTTGTCCTT
GCGGGGTGTGCCACAATCCTTCCGTGGGGAAAGGCGTACGGAGTCTTCAA
CGCGAAATGGCTTTATATCCTCGCTGTTTTGATCTTCGAAATCGGTAGCG
CAGTTTGTGGTGCTGCGCCTAATATGAATGCTCTCATCGTTGGGAGAGCT
GTTGCTGGTCTTGGAGGTTCGGGAATGTACCTTGGTTCATTGAATTTACT
GTCAGTTCTCGGACCCGTCGTCGGCGGCGCTTTCTCCGAATCTCCAGCAA
CCTGGCGCTGGGCATTT

Sequences in the Contig:

SY0AAB25YI14FM1