Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YI04FM1
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00002097001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212074.1| Score: 284 E_value: 6e-24
KEGG Definition: hypothetical protein
Accession: ani:AN9378.2 Score: 262 E_value: 1e-21
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism, General function prediction only].
Kog Number: KOG1610 Score: 120 E_value: 2e-07
PFAM Definition: No Hit Found
Swissprot: P37959|YUSZ_BACSU

Sequence:
>SY0AAB25YI04FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGTCCAGTGCCAGCCTGCAAC
CTCTACGACGCGAGCAAAGCCGCTCTCCGGCTCATTGGCGACGGCCTCAA
CTCCGAACTCGCGCGCTTCGGCATAAAAATTACAACCATCGAACCGGGCA
TGTTCCGTACAGAACTCCTCGACCCGAACGTGAACTTCATCAAGACCAGC
GACGACAAGCGCATAGAGGACTACCGCGAAATGAACGAGACCACCGATGG
TATGTTCCGCAACGCGCATGGGAAGCAAATGGGGGACCCGAAGAGGGGAG
CTGAGGTCATCTATGAGGTGCTCACGCAGACCGGCGTCGCGCAGGGGAGG
GAGATTCCGCTAGTGCTGGCGCTCGGGAGCGATGCTGTTTCTACCATTCA
GAAGTTTGCCAGGGATCAGGCGGATTTGGTGAAGAGTTGGGGGGAGGTTA
GCTCCAGTACGGATTTCCCGTAAGGGGGAGCGGGGGGTACTTCCTTTGGG
TGGTTGATTCCATTTTCTTGTTCTGAATTGAATCTGTTTGTAGGGGATGC
AATTGGGCTGGATCGGATGCAGTTGGGAATTATAAAATACTCCGAGCATG
CATATCCTTGCGCTCGGAGGGTTGATCGTATGCCGGCAG

Sequences in the Contig:

SY0AAB25YI04FM1