Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YE09FM1
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00002483001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08163
Accession: ref|XP_001241000.1| Score: 628 E_value: 9e-64
KEGG Definition: C2H2 finger domain protein, putative
Accession: afm:AFUA_7G05960 Score: 606 E_value: 2e-61
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q12139|YP022_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAB25YE09FM1
TTGGAGCCCTCCTCAAGAGTCTCTTTTGTCCGAGCATAAACGGCAGGACT
TGATGGATCATATTGAAAACTATCCCGAGATGTCTGATCTTTCGCAGCGC
ACAGGCTCTTTAGTGCTCGGTTCCGCCGAAGATGACTCACACGCTTTGAG
TTTACATATGATGCAGTCTTATATTTCTAGCTATTGGCTTCACTTTCATC
CACAGCTTCCCATTCTTCACAGGCCAACGTTCTCGGCCGACAAAACCCCT
AGCCTCCTCCTCCTCACAATGATGGCCATCGGTGCATCCCTGATCGGCAC
CAAGGTGGACCCGACTGTCGCCCAAGCAGCAACAGACCTGTCTGTTATTC
TGGCCTGGAATCTTCGATGGCAGATATTTTCGGATATGGCTTTCCGGCCT
CCAGCGAAATTATGGGTCTTTCAGGCGTTGCTTTTGTTGGAAACTTTCGA
GAAGATGTTCGCATCCAGGGCGCTTCATGAGCGGGCTCATATACACCATG
CTACCACTCTTACACTGATGAGAAGAGGTTCATCACTGACTGGAAGGTGT
GCCTACGATTCCCCACAAAGCGGACGTGATGTCAAGTCCAACAGTGACAA
CGGCAGTGCAGCGTTTTCTGGCCAATCATCGGGCTCCGCACCAGTGGAAG
ATGCATGGAATCGATGGATCGTTAGCGAGGCGACAAAAA

Sequences in the Contig:

SY0AAB25YE09FM1