Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YD16FM1
Length(NT) : 561
Best Gene Model Blast : Link to GSTUMT00003839001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU09708
Accession: ref|XP_958947.1| Score: 343 E_value: 6e-31
KEGG Definition: hypothetical protein
Accession: ncr:NCU09708.1 Score: 343 E_value: 3e-31
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2061 Score: 271 E_value: 4e-25
PFAM Definition: PDCD2_C, Programmed cell death protein 2, C-terminal putative domain..
Pfam Number: pfam04194 Score: 205 E_value: 2e-17
Swissprot: P25040|YO022_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAB25YD16FM1
TTGGCCCTGGCCCGAGAAACTCCCCCACGAATACCCCCTCTTCCATTTAG
ACGCCGAATACGAAGCTGTAGAGAGAACCACCGGGCTCAAAGCCCACCAA
CTCAGAAAGTATGAAAGACTGATGTCTCAGACGGGGGATGATGATGACGA
AAATGAAGGCGGCAAGTCCGGACAGGACAACAGCACCCCTTCCAACGATC
AGATCGACGACGACGTATTCCAGAGATTTGCCGACCGGATAGCTAATAAT
CCAGAGCAGGTATTGCGCTACGAGTGTGGGGGCACGCCGTTGTTCTACGC
TGTGTCGGATGATGTCGGAAGGCTTCTGAATCCGAATGATGAGGGGTTCC
TCGCTACGCGGATACCCAAGTGTGGGAATTGTGGAGGCTCCACGAGGGTG
TTTGAGTTTCAAATCATGCCTCATGCTATCACTGTTCTTGAGGGCGATGA
TGAAGGGTTTGACGGAATGGATTGGGGGACTATTATGGCCTTCACGTGTA
AATGCGTACCAAAGGCTCTGGATAGGAATATGGTTGGCTATGTTGAAGAG
CACGTCTCTGT

Sequences in the Contig:

SY0AAB25YD16FM1