Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YD15FM1
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00011958001 E-value : 9e-18
Numbers of ESTs : 1

Blast Results:

Nr Definition: 14-3-3-like protein
Accession: emb|CAC20378.1| Score: 131 E_value: 8e-10
KEGG Definition: hypothetical protein
Accession: mgr:MGG_13806 Score: 131 E_value: 2e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB25YD15FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTCCTCTCTTTCAAAGCAC
AAAGCTCTTTCTATCCTTCCTCCACCACTACCACCCCCACAAACCACCCC
CACTGAAAACCCCTTCCACATCCGCATCTTCAGCTGCTATCAACAACCTC
CCTCCCTCCCCTCCTCCCCCTCATCCTTCAACTTGCGTTTAATCTCCAAA
TAAATACACAAACATCTAAACTCCACCAAAACATCATGACTACCGAGGTA
TGTGCCAGAAACTGGTTTTTAACCTTTACTCTTCATTCCCTGCAGGACCC
CTCCTTGCTCATCAAAACAACCCCAACCCCCTCTTTAATACCCGTCATCA
TCAACTCTTTTCCACCAAGAATGTCGCTAATGATTATTTCGTTTGTTGTG
ATTACAGCGCGAGAGCAAGACTTTCCTCGCCAGATTGTGCGAGCAGGCTG
AGCGTTACGATGAAATGGTTACTTATATGAAGAGCTGACATATCTATCGT
TACAACGATAGAATTCCTGGCATCCGATCGGCCCGATCGGCTCCATAGAT
TTGAAGCTGAATCCGGCGCTAACTGGTGGTTTTATCAGCTTGGCGGCGAA
CTCTCCGTTGATGAGCGTAATCTACTTTCGG

Sequences in the Contig:

SY0AAB25YD15FM1