Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YD11FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00001361001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65571.1| Score: 244 E_value: 3e-19
KEGG Definition: ankyrin repeat
Accession: aor:AO090103000097 Score: 244 E_value: 1e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB25YD11FM1
GCGAAGAACCGAAACAAAAACAAAAAATGTCCCAAGTTTCTAGCAATAAC
GTCAACTCCTTCAACGTGTCGAATAACTTCAACCTTGGTGTTGGGGATGA
GGAGTCAAAGATTCTAGCCTGGTTATCACCTCTGGAGCCACGGATGCGAC
ATCACGATATCAGGGCTCAGCGGGTGGAAAACGTAGGAGAGTGGCTACTT
CGAACAAAAGAATACAGGAGTTGGTGTAATGGTTGCGAAAAGGATGAATC
CTACCGTGCGGGCTTGTTGTGCTATGGCCATCCGGGAGTTGGCAAGAGCT
TCATCACTTCGCTAGTGATAGACTCTTTATGCGACCGGGCTAGAGGAAAA
AATGTTGCCGTCACTTGTTTTTACTTTGACTTCGCTTCCCGGAAGGAACA
GACCCCCGTAAATATGCTGGGTTCCCTGCTCAAACAGCTTGTTACTGGAT
TGGAAGAAATCCCGGAGGGGGTGGTGGAGGAATACCGAGAGCAGAAGAAG
GTGATTGGTGGCCGAGGATTAGGGGTTTCAGGAATTGTCAGGATGCTCCA
AACCGTCTCGTCTACAAAGCACACATTTATATGCATTGACGCTCTTGATG
AATGTGCGCCGGAGCACCGAGTCGAGGTTCTTATTACCCT

Sequences in the Contig:

SY0AAB25YD11FM1