Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB25YB15FM1
Length(NT) : 605
Best Gene Model Blast : Link to GSTUMT00010855001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 486 E_value: 2e-47
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 440 E_value: 2e-42
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 268 E_value: 1e-24
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAB25YB15FM1
TTGGAGCGGGGAGAGGTCGACCCCGACAAGCCAGGTAGTGACGGCTCAAC
ACCGCTCTCGTGTGCCGCTTCGAGTGGAAATGAGGGAGTGGTGAAATTAC
TCCTAGGGCGGGGAGAGGTCAACCCCGACAAACCAGATGATTACGGCTGG
ACACCGCTCTTGTGGGCCGCTTTGAGTGGACATGAGGGAGTGGTGAAATT
ACTCCTAGGGCGGGGAGAGGTCAACCCCGACAAACCAGATAATAACGGCC
GAACATCGCTCACGTGGGCCGCTTCGAGTGGACATGAGGGAGTGGTGAAA
TTACTCCTAGGGCGGGGAGAGGTCAACCCCGACAAACCAGATAATAACGG
CCGAACATCGCTCACGTGGGCCGCTTGGAGCGGACATGAGGGAGTGGTGA
AAATACTCCTAGGGCGGGGAGAGGTCAATCCCGACAAGCCGGATAATAGC
GGTCGAACACCGCTCTCGTTTGCCGCTGAGACTGGACGTGAAGAAGTGGT
GGGCATACTCCTCGGGTTAGAAGCCGTCAACCCCGACACGCCGGCCAAGT
GGGGTCAGACACCGCGGTCCCTTGCTACCATGTGCGGCCATAAAAAGGTA
GTAGC

Sequences in the Contig:

SY0AAB25YB15FM1