Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YN22FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00002429001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: F-actin-capping protein subunit beta dbj|BAE55822.1| unnamed protein product
Accession: sp|Q2URJ3|CAPZB_ASPOR Score: 845 E_value: 6e-89
KEGG Definition: F-actin capping protein, beta subunit
Accession: aor:AO090005000806 Score: 845 E_value: 3e-89
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3174 Score: 691 E_value: 1e-73
PFAM Definition: F_actin_cap_B, F-actin capping protein, beta subunit..
Pfam Number: pfam01115 Score: 723 E_value: 2e-77
Swissprot: Q2URJ3|CAPZB_ASPOR

Sequence:
>SY0AAB24YN22FM1
TTGGCTCTTACTAACTTTATCCCAAGTTCACGCTACAGCTGAGAATTATT
CCGATGGCTTCTCAAGATCCTTTCGATTCCGCACTCGACCTTCTCCGCCG
TCTTAATCCGAAATATACGGCAAACAATGTCAATGCTCTTATCAATCTTG
TCCCAGACTTGACCGAAGACCTCTTGTCATCCGTAGATCAGCCCCTTCAG
GTCCAACGCTGTAAGAAGACTGGGAGGGACTATCTTCTTTGTGACTACAA
TCGTGATGGAGATTCTTACAGATCCCCATGGAGCAACGAATTTGACCCCC
CTCTCACAGACGGTACTCTACCTAGTGAAAGGGTTAGAGGGATTGAAATT
GCTGCTAACGATGCCTTCGACATTTACCGGGAACTGTATTATGAAGGTGG
TGTTTCAAGTGTCTACTTCTGGAACCTTGACGACGGGTTTGCCGGTGTAG
TTTTGCTCAAAAAATTTGTTTCATCTGCCAATGAATCAACTGGTTCTTGG
GATTCAATTCACGTTTTTGAAGCTACCGACAGGGCCCGAATCTCCCATTA
CAAGCTCACTTCTACGGTTATCTTGAATATGATTAATGGAGACGAATCCC
TAGGGGAGATGGATTTGAGTGGAAACATGACTCGGCAGGTTGAACAAGAT
ATGCCTGTTGGAGACGAT

Sequences in the Contig:

SY0AAB24YN22FM1