Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YN21FM1
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00005225001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_09336
Accession: ref|XP_001799631.1| Score: 520 E_value: 3e-51
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04855 Score: 480 E_value: 6e-47
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0054 Score: 305 E_value: 6e-29
PFAM Definition: No Hit Found
Swissprot: P32386|YBT1_YEAST
Gene Ontology:
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0015125 = Molecular function: bile acid transmembrane transporter activity
GO:0015721 = Biological process: bile acid and bile salt transport

Sequence:
>SY0AAB24YN21FM1
TTGGGTAGACCCTCTGATTTGGAAGGGCTATTGGAAGTCATTTGAGCTTC
ACGACGTCTGGAATCTCCGAAATGATGATATCGCTGTTACAGTTTTGTCA
ACTTATCGCCAAACCAGAAAAGCGCATACACTGGCTTGGACATTGGCAAA
ACATTTTAAGCGCGAACTTGCGGTGCAGGCTGCTTGGGCGGTTTTCTATT
CGATGTTTACTTTTGCGCCTACGTTACTGCTACGAATCATCCTGCAGTAT
GTTAAGTCGCCGGAGGATACGCCTAAGAATGTTGCATGGCTGTTTGTGGT
ATTGCTTTTCGTCACTGCGACTGTCCAGGCAATTGGTAGCGGCCAAGCTC
TCTACATCGGTCGGAGGATCTGTATCCGTCTTCATTCTGTGATTGTTGGC
GAGATTTACGCAAAAACTCTCAGAAGGAGAGCAGCGGCCGGGGCAGATCG
CGCATTAGGACCAAAAGGCAAACACGATGGAAAGAAGGATAGTGAAGGCA
AGGCTATTGCGACTGAAGACAATGGAGAGCAGGCAAATGCTGGTGCAATC
ATCAATCTGATGTCTGTTGATTCGTTCAAAGTGGCAGAAGTTTGTGCTTA
CCTACACTTCCTGGTTGCGGGTGTTCCGGTACAAGTGGCGATAGCCGTAG
TTCTTCTATA

Sequences in the Contig:

SY0AAB24YN21FM1