Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YN04FM1
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00005449001 E-value : 1e-102
Numbers of ESTs : 1

Blast Results:

Nr Definition: ubiquitin precursor
Accession: gb|AAA84868.1| Score: 599 E_value: 3e-73
KEGG Definition: hypothetical protein; K08770 ubiquitin C
Accession: ani:AN2000.2 Score: 596 E_value: 2e-73
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0004 Score: 352 E_value: 3e-34
PFAM Definition: ubiquitin, Ubiquitin family. This family contains a number of ubiquitin-like proteins: SUMO (smt3 homologue), Nedd8, Elongin B, Rub1, and Parkin. A number of them are thought to carry a distinctive five-residue motif termed the proteasome-interacting motif (PIM), which may have a biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites..
Pfam Number: pfam00240 Score: 276 E_value: 2e-25
Swissprot: P61864|UBIQ_YEAST
Gene Ontology:
GO:0022625 = Cellular component: cytosolic large ribosomal subunit
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0016567 = Biological process: protein ubiquitination
GO:0042254 = Biological process: ribosome biogenesis and assembly
GO:0006412 = Biological process: translation

Sequence:
>SY0AAB24YN04FM1
TTGGCGTTCATCCACTCCTCCGATCACCACCAACATTACCTATAACAAAG
CTGCCATCGTTACACTCAACGTACCCCGATTCATCAGAAATCATCTATAA
AGATCATCCTTCAAGCTCTTTGATTGAACAAAATGCAGATCTTTGTTAAG
ACTCTTACTGGAAAGACCATTACCCTCGAGGTCGAGTCATCAGATACCAT
CGATAACGTGAAGAGCAAGATTCGTGAGTGCTCAAGTTTTCCCTATTGTC
AAGTGTTTGCATGTTTGATTCTGACTTATTTTTATAGAGGATAAAGAAGG
AATTCCCCCAGATCAACAACGTCTCATCTTCGCTGGAAAGCAACTTGAAG
ACGGTCGGACTTTGTCTGATTACAATATCCAAAAAGAATCTACTCTTCAC
TTGGTTTTGCGGCTGCGCGGAGGAATGCAGATTTTCGTGAAGACTTTGAC
CGGGAAGACCATCACCTTGGAGGTAGAGAGCTCAGATACAATTGACAATG
TCAAGAGCAAAATCCAAGATAAGGAGGGGATCCCTCCGGATCAGCAGAGG
TTGATATTTGCTGGGAAGCAACTCGAAGATGGAAGAACATTATCGGATTA
CAACATTCAAAAGGAGTCGACCCTACATCTTGTTCTCCGATTAAG

Sequences in the Contig:

SY0AAB24YN04FM1