Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YE07FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00003051001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG3262 Score: 123 E_value: 9e-08
PFAM Definition: No Hit Found

Sequence:
>SY0AAB24YE07FM1
TTGGAGCGAAACCCCGACCAGTTGCAAGGCGAGGGGCAGCGACCTCTAAT
TGCGCCCCCATTCCGGGTGATTCGATTACACCCCCAGAAAACCCCACGGA
TAGCCCAGCGCCAGTCAAAGTTCCTTCTTCAGTGGTAACAACTGCAGCAG
AACCGGTGCAGAATCTTCCAATCCCCCCTCCAGTCGGCCGTTTAGACAGC
TTATCTGCAGCTCGAAACCCTTCTACCAGTGCTCGGGGAGCAGCCCCATT
AGTCAAGTTTAAACCCAGAAATCCTGGCCGGCGCACACAAGAAGAACGAG
AAACCCTCAATGCTAGGTTCCAACATACCGCTAATCCAGCCCCTCACCCC
CGAGCCAACGGGTCAGATCATGAGACCAGGGGTAGAAGGGGTGGGCGAGG
CGGAAGAGGTGGAAGAGGTGGAAGAGGTGGAAGAGGTGGAAGAGGTGGCC
ACAACGCTGTATCCGCTTATGCACCAGCTACTGGCATCAGGACCTTTTGC
TTTAGGAAGTGTCTCTACAGGTGCTCCAAGATCCAGGGTTGCCGTCGAGC
GTGGCATGGATCGTGAAAAATACAAAGAATTCACTAGATCCGGTGCAAAG
CGTGACATAAAGACCCGAGCAAAGCTAGAGGGTGAAGGCGAGGATGGGAA
AACTCTCGGATATACATC

Sequences in the Contig:

SY0AAB24YE07FM1