Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YD23FM1
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00007225001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ankyrin repeat domain protein
Accession: ref|XP_001258986.1| Score: 356 E_value: 3e-32
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 353 E_value: 3e-32
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 231 E_value: 2e-20
PFAM Definition: No Hit Found
Swissprot: Q02357|ANK1_MOUSE
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0048821 = Biological process: erythrocyte development
GO:0015672 = Biological process: monovalent inorganic cation transport

Sequence:
>SY0AAB24YD23FM1
TTGGGGGAGTGGTAAAAGCACTGCTTGGACGGGACGACATCAGTCCCGAC
AAACCAGATAACAACGGCCAAACACCACTCTGGTGTGCCGCTCGGAGCGG
GTACGTGGGAGTGGTGAAAACACTGCTCGGATGGGGCGATATTAATCCCA
ACGCACCAGATGATGATGGCCAAACGCCACTCCATACTGCAGCCTGGAAT
GGGCACGAGGAAGTGGTGAAAGTACTGCTCTGGCGGAACGATGTCGACCC
CAACAAACTAGGAGGCGATGGCCAAACACCACTCGGTTGGGCCGCTAGGC
ACGGTGACGGAGGAGTGGTGAAAGCGTTACTCGCACGGGGTGACACCAAC
CCCGACAAGCCTGACCACTTAGGCCGAACACCGCTCTGGTGGGCCGCCGA
GCATCGCCATGCAGGAGTAATGACGCTACTACAGTGCCCAACATCTGCCA
CCCGTAGCACAGGCTAGGGTACAGGGGGCGTCTCCCAAATACGGGCTTTC
AATCTACCAAGTGCGCATGAAAAACAGCTCAAGGAAGATTTCTACTGCCG
CCGTCGCCTCTCTCGCCCCCGCCCGGTCTCCTCCCACAGTTGAAGCGCCA
CGTTCTCGTCGCAGCCGTCTTTCCCTCCCTTCTGGGGTA

Sequences in the Contig:

SY0AAB24YD23FM1