Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YC13FM1
Length(NT) : 688
Best Gene Model Blast : Link to GSTUMT00012125001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Chain A, Structure Of The Chitin Deacetylase From The Fungal Pathogen Colletotrichum Lindemuthianum
Accession: pdb|2IW0|A Score: 375 E_value: 2e-34
KEGG Definition: hypothetical protein [EC:3.5.1.41]; K01452 chitin deacetylase
Accession: mgr:MGG_09159 Score: 350 E_value: 8e-32
KOG Definition: No Hit Found
PFAM Definition: Polysacc_deac_1, Polysaccharide deacetylase. This domain is found in polysaccharide deacetylase. This family of polysaccharide deacetylases includes NodB (nodulation protein B from Rhizobium) which is a chitooligosaccharide deacetylase. It also includes chitin deacetylase from yeast, and endoxylanases which hydrolyses glucosidic bonds in xylan..
Pfam Number: pfam01522 Score: 147 E_value: 2e-10
Swissprot: O34798|YJEA_BACSU

Sequence:
>SY0AAB24YC13FM1
TTGGCAATGACCAGGCGATGAAGGACACCCTCAAAAGGATTATGGCAGAT
GGCCACCAAATCGGTTCTCATACTTTCTCCCATAAACCTTTGTCTCCTCT
CTCGGAGATGGATAAGATTTCGGAAATGGTCAAACTCGAGAATGCCCTCC
ACGGAATCATTGGCAAGAAGCCTACTTACATGCGCCCCCCGAGCTTTGAA
TGCAACGACAAGTGCATGAAGTTCATAGAGGGGCTTAGATACCACGTCAT
TAGTGAGAACCTCGACGCTCAGGACTGGAAGAACATGGGCAACATGCAAG
TATCCAAGGACATCGTCAACAAGGCCGTAGATGGGGCCGACTCCAAGAAG
AACAACTTTATTGTTCTTGCTCACGACATTCACGGGGCTACCGTCGAGCA
GTTGGCTTAGCACATGATTGACAAGTTCAAGGGGAAGGGATACAGATTCG
TCACCGTTGGAGAGTGCCTCGGGGATGCATCAGAGAACTGGTACAGGAAC
AAATAAGGCCGTTCGCTAGATATTGTGTCAACACCCTCGTTCTTAGCGGA
GGGTACCTTTTCTTCCCAGTCACTCTTTTCTTCCTCTTCCTTATTGAACA
TGTCACTCCATCCCCCTTTTTTAATAGCGATGGTTTCTTTTCTTTTATTT
ACCGAAACCTACCGCTCCAGTCCGGAGCGATCCGATGT

Sequences in the Contig:

SY0AAB24YC13FM1