Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YC06FM1
Length(NT) : 691
Best Gene Model Blast : Link to GSTUMT00003900001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_10642
Accession: ref|XP_001588196.1| Score: 621 E_value: 6e-63
KEGG Definition: hypothetical protein [EC:1.14.-.-]; K04712 fatty acid desaturase
Accession: ani:AN4405.2 Score: 598 E_value: 1e-60
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG2987 Score: 473 E_value: 2e-48
PFAM Definition: Lipid_DES, Sphingolipid Delta4-desaturase (DES). Sphingolipids are important membrane signalling molecules involved in many different cellular functions in eukaryotes. Sphingolipid delta 4-desaturase catalyses the formation of (E)-sphing-4-enine. Some proteins in this family have bifunctional delta 4-desaturase/C-4-hydroxylase activity. Delta 4-desaturated sphingolipids may play a role in early signalling required for entry into meiotic and spermatid differentiation pathways during Drosophila spermatogenesis. This small domain associates with FA_desaturase pfam00487 and appears to be specific to sphingolipid delta 4-desaturase..
Pfam Number: pfam08557 Score: 171 E_value: 2e-13
Swissprot: O59715|DSD1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0042284 = Molecular function: sphingolipid delta-4 desaturase activity
GO:0000747 = Biological process: conjugation with cellular fusion
GO:0009966 = Biological process: regulation of signal transduction
GO:0046512 = Biological process: sphingosine biosynthetic process

Sequence:
>SY0AAB24YC06FM1
TTGGACCACCAGCCCGTCCACCCCTTTCTTTACCGCTGCTCACCACCTCT
GCTTCCATCGGATGACCCAATTCTCCTCCCCATGACAGCTTGCGAATAAG
GAATCTCCCACCATCGATATATCGATCTTCTGCCTAGCTTTTCCTTTATC
ACCACTCCTTCAGACCATTCCTTTTCCGACTGTTAGCTCATCGTTACTTT
TTAATTCTCATGACTTCCGTTATTGAGATTTCCACCATGGCTCCAGCCAA
GGCCTCTAAGCAGGCTGCCCATGATTGGCTTTGGACTTACCAAGAAGAGC
CCCACCGAACTCGAAGACACCAGATAATTAAGGCCCATCCTGAGGTTACC
AAACTCTGCGGCCCAGAACCTCTGACCAAATATGTTGTCCTCTTCGTGGT
TTCCCTACAAATCTTCTGTGCATTTATTCTGCAATCGACCCCGGTATTCT
CGTGCCAGTTCTTTCTTATGGCCTATATTATCGGAGCAACTGCGAACCAG
AATCTTTTCTTGGCTATTCATGAAATATCCCACAATCTCGCTTTCCGCTC
AGCTTTTGCCAACAGAATGATTGCTATATTTGCCAATCTTCCCATTGGAC
TTCCGTACAGTGCAGCTTTTCGCCCATATCATCTGACCCATCACAAGGCA
CTTGGTGTTGACGGCCTTGACACTGACCTTCCGACAAAGAT

Sequences in the Contig:

SY0AAB24YC06FM1