Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB24YA03FM1
Length(NT) : 687
Best Gene Model Blast : Link to GSTUMT00008471001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An12g05680
Accession: ref|XP_001395633.1| Score: 304 E_value: 3e-26
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 304 E_value: 2e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>SY0AAB24YA03FM1
TTGGCGAGGTATATTTTCGAATCAATAACTCGCACAAAGAGTCCGCACAA
ATTTTTCACCATCTTTTCGAACCCAGCCAGATTCCCGATGTCCTTGGTTG
ACTTGAACTCCCGCCTGATTCGGAATGCGATGTTCATCTCTTGGAGTGTA
AGAGGCCTCGCTGCCGCCACCACGATATTAAGGATTCGTCGGGCTTTGTC
GGGGCTTTTACTCTTATCAAGAATCCTGGTGTATAGTTCTGCTATATCGG
GTGGTGCGGTGGAGACAATCTCGGTGAAGGCCTCCGGTGATCCATCCTCG
CTATTCCGCAAAATATCAAGAACAAGAGAAACCCAAAGGAATGTCCGATC
GGCGGAAGATTCGAGAAGATTTCGCAAATATCCCAGCCCCCCGGGCTGTT
CCCAGTATGACTCTAGGTCTTCAATCCCTGCTTCTATGACACGAGTAACA
TCGGCAGTGGTAGCGGTGACCTCTTCCTCCCCTTTCAACCTGATGGTGGT
TGCGGGTGAGCCTAGCTGTCTCTCGATCTTGTGGTAGGGGCGACTCGTAA
CTAGAAATTTCAAAGGAATATAAGAAGTCTCTGACCCAGGGAGATTGGTG
GCATGATGGATAAGCCGGGTTAAAGTCCCTTCGTCACACTCGTCCAATGC
ATCCACCACACAAATTACATTGCCGCACCCCCCCTCA

Sequences in the Contig:

SY0AAB24YA03FM1