Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YJ10FM1
Length(NT) : 721
Best Gene Model Blast : Link to GSTUMT00011312001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: GTP-binding protein Obg
Accession: gb|EDP56784.1| Score: 364 E_value: 4e-33
KEGG Definition: GTP-binding protein Obg; K03979 GTP-binding protein
Accession: afm:AFUA_1G15500 Score: 364 E_value: 2e-33
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1489 Score: 227 E_value: 8e-20
PFAM Definition: GTP1_OBG, GTP1/OBG. The N-terminal domain of the Spo0B-associated GTP-binding protein has the OBG fold, which is formed by three glycine-rich regions inserted into a small 8-stranded beta-sandwich these regions form six left-handed collagen-like helices packed and H-bonded together..
Pfam Number: pfam01018 Score: 254 E_value: 7e-23
Swissprot: P42641|YHBZ_ECOLI

Sequence:
>SY0AAB23YJ10FM1
TTGGGCAAGGTTTACCGCAGAGCTCCAGGATCTGGATTACTCAGTTAAAT
ACATGGACACCGTTCTTATACCCATTTCTGGCCCCAGGCATTGCGGCACG
ACCCCTCACCCCCACCCTATCACGGCCCCACCGTCGTGCCCTGTCAACCA
CTACAGAACAGCCAGAGTTAAGAAGTAATGTCAATTCAGTACAGCATCAA
TTGGTAGAAGAGGATGTAGAACTGGTATCGGTCCAGCAGCCCCAGCATCC
CTATGCGGAATACTCCACTGCCCCATTTGCGGATATGCAAGAGTTGACTC
TGATTGCTGGCTCTGGTGGCAACGGCTGTGTTTCATTCTTACGAGAGAAA
TTCATCCCTTACGGCCCCGCAAACGGCGGGAATGGCGGCAGCGGAGGTTC
GATATTCGTTCAAGCTGTCTACGGCGAGACATCACTTCATAAGCTCTCCC
GAGAAGGCACGATTCGGGCAAAGCCAGGAAGAAACGGAAAGGGTAGCTCT
ATCAACGGGAAGCGAGGGGACGACGTAATTATTCGGGTCCCCGTTGGCAC
AGTTCTCCGGGAAATCTCCCGCTGGGACCCAGTAGGGGAGGAGTTGGAGG
AGCTGCCGGATGGGGATGTTGGCGATAAATCTAAACAACATGGCCGTCAC
GACGAATGGGTTCATTACCCACGCAGCGCCGCTGAGAACACCATGAGCGA
GGGCTTCATGGCGGTAAAGTA

Sequences in the Contig:

SY0AAB23YJ10FM1