Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YI16FM1
Length(NT) : 533
Best Gene Model Blast : Link to GSTUMT00003410001 E-value : 4e-75
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG4364 Score: 159 E_value: 4e-12
PFAM Definition: RNA_polI_A34, Yeast RNA polymerase I subunit RPA34.5. This is a family of yeast proteins. Subunit A34.5 of RNA polymerase I is a non-essential subunit which is thought to help Pol I overcome topological constraints imposed on ribosomal DNA during the process of transcription..
Pfam Number: pfam08208 Score: 132 E_value: 6e-09

Sequence:
>SY0AAB23YI16FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCTTTTACGCGAATGGAACTGCACCTCAAAAGAACCAGGATGC
GATGAAAGATGCCATGGACGCCGTTCTCGCAGACATCGCAGTTGACGCCG
ACGAAGATGACGGGCAGGTCGACCTAGAAATGGCAGACATTGTCAAACCC
AAGAAGTCCAAGGACAAGAAGAAGGAGAAATCCAAGGAGAATAGAGAAGA
AAAGTCCGACAAAAGGCAGGGGAAGGAGCAGAAGGAGCAGAAGGATAAGA
AGGGTAAGAAGGGTAAAAGGGATAAAAAGGATAAAAAGGATAAAAAGGAT
ATAGAAAGTAAGAAGAGACGGCGGGACGAGGAGGAAGATCAGGATGTATC
GGAGAGAAAGAAGTCAAAGAAGGAGAAAAGGGAGAAGAAGGAGAAGAAGA
GTAAGGCTTAAAAATGAGTACATTATATCAATACTTATTCACTCTTGTCA
CGGGCGTCACATTTCTTTGAGTTTTCTTTTCTT

Sequences in the Contig:

SY0AAB23YI16FM1