Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YI07FM1
Length(NT) : 562
Best Gene Model Blast : Link to GSTUMT00011424001 E-value : 1e-161
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06952
Accession: ref|XP_001797309.1| Score: 331 E_value: 2e-29
KEGG Definition: eukaryotic translation initiation factor 3 subunit EifCh, putative; K03247 translation initiation factor eIF-3 subunit 3
Accession: afm:AFUA_1G09970 Score: 313 E_value: 1e-27
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1560 Score: 223 E_value: 2e-19
PFAM Definition: No Hit Found
Swissprot: Q9UT48|EIF3H_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005852 = Cellular component: eukaryotic translation initiation factor 3 complex
GO:0005634 = Cellular component: nucleus
GO:0006413 = Biological process: translational initiation

Sequence:
>SY0AAB23YI07FM1
TTGGCAGCGACAGCTCGCCCGTGAGCAAACTAAGATCGCAGCGTGGCTCA
CTAAACGGAAACAGGAGAATATCCTTCGCGCAGCGGCCAAGCAACCTCTA
CTCCCGGAGAACGAGTGGACCAGACTTTTCAAGCCACCCGTCGAACCTAG
CCGGCTCGAGACTCTCCTTAACTCCAGGCAGATCGAGCAGTACGCAAAAC
AAGTTGACGGGTTCACAGCTAGCGTCACGGCTAAGATGTTTGCTGTGAAT
GGGGGATTATCAAAAACACAGGAGCAGTTGCAGTTGTAGGCTTAACACTG
ACTTTCTCTTTCTCTCTCTCTTCTTTCTTCTTTCTTCTTTTTTAGGTTAA
TACGTTGTTGTGGACTGTGGTGCAGAAACGCATGATACAATTTGTTCCCC
TTTTCCTCTCACCTCTAATAGCTTATACTAGGGTACTTAACTAGGTGACC
TGTGAGTTTAAGCTAAGATATCCCATGTTGCAATGGGGCTGGGAAATGGG
ATAGAAAGCGAAATGTTCAGATTTGCGAGTGATATTTGGTGCTGGTAGAT
GGGTTATGGGAG

Sequences in the Contig:

SY0AAB23YI07FM1