Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YG11FM1
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00010272001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_13795
Accession: ref|XP_001803998.1| Score: 920 E_value: 1e-97
KEGG Definition: hypothetical protein
Accession: fgr:FG05499.1 Score: 890 E_value: 2e-94
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0903 Score: 778 E_value: 1e-83
PFAM Definition: PI3_PI4_kinase, Phosphatidylinositol 3- and 4-kinase. Some members of this family probably do not have lipid kinase activity and are protein kinases..
Pfam Number: pfam00454 Score: 299 E_value: 3e-28
Swissprot: Q10366|YDBG_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0008104 = Biological process: protein localization

Sequence:
>SY0AAB23YG11FM1
TTGGCGAGCGCAAAGCAGACAGAGATGATCCTAGCGCAGCAACCTTTGGA
GAGGAGTGGAGCGCAAAGCGGGAGCGAATCCGGAAATCTTCTCCATATGG
TTGGTGTAAGAATTGGGATCTATTAAGCGTAATTGTGAAGACAGGTGCCG
ACCTGAGGCAAGAGGCATTCGCATGCCAACTTATTCACGTATGTGGCAAA
ATTTGGGAGAAGGCCGATGTGCCTGTATGGATAAAAAGAATGCGAATTCT
TGTTACCGGAGAGTCGTCGGGGTTAATTGAGACCATTACAAACGGAACTT
CTCTTCACTCCCTGAAACGGAGTCTCACCATAGCATCCATAACCTCTATG
AAGAACCCTCGGGGGCGAATTGCGTCTCTTAAGGACCATTTCGTGAAAAC
ATTTGGCGAACCTGAGTCAGATACGTATAAAACAGCAGTAGGCGCATTCA
CACAGTCACTGGCAGCGTACAGCATAATATGCTATATTCTGCAGTTGAAG
GATCGACATAATGGTAATGTCTTAATAGACAATCAGGGCCACATCATTCA
CATCGACTTCGGTTTCATGCTGTCCAATTCCCCTGGCTCCGTAGGCTTCG
AGTCTGCTCCGTTCAAGCTCACCCAGGAGTATGTCGATGTCC

Sequences in the Contig:

SY0AAB23YG11FM1