Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YF11FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00008539001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: photo-regulated tyrosinase
Accession: dbj|BAD51402.1| Score: 166 E_value: 3e-10
KEGG Definition: hypothetical protein
Accession: ncr:NCU08615.1 Score: 136 E_value: 4e-07
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG2418 Score: 170 E_value: 3e-13
PFAM Definition: Trypan_PARP, Procyclic acidic repetitive protein (PARP). This family consists of several Trypanosoma brucei procyclic acidic repetitive protein (PARP) like sequences. The procyclic acidic repetitive protein (parp) genes of Trypanosoma brucei encode a small family of abundant surface proteins whose expression is restricted to the procyclic form of the parasite. They are found at two unlinked loci, parpA and parpB; transcription of both loci is developmentally regulated..
Pfam Number: pfam05887 Score: 220 E_value: 4e-19
Swissprot: P00440|TYRO_NEUCR
Gene Ontology:
GO:0004503 = Molecular function: monophenol monooxygenase activity

Sequence:
>SY0AAB23YF11FM1
TTGGGATTTGTCAACTTTTGTCACAGGTAGGGTCAACGAACTTTATAGGC
CTGCTTTGGGTGGCGGTGGTGGCAATAATCCAGGCCCCGGCACCGGCACG
GGTACTGGCAATGGCACCGGCACAGGTACTGGTTCGGGCTCTGGTTCTGG
CTCTGGTTCTGGCTCTGGTTCGGGCTCTGGTTCTGGCTCTGGTTCGGGCT
CTGGTTCTGGCTCCGGCTCTGGCTCAGGAACTGGCAGTCCCTACAGATAC
CGTCGCGAATGGATCGCCTACATCAAAATGGACACAGGCGAGGTCGATGA
TAGATACTCTGTCTTGATCTTCCTTGGAGACGTCCCATCATCCGTCCAAG
AATGGCAAACTGCACCAAATCACGTTGGCGACTGCTCAACATTCGGCGAC
GAGAGATCGCGAATGAAACACGTTATCCGAGGCACTGTACCTCTGACCGA
GGCCCTCGTCGCGAGCAATGTCGACCTTGACCCGGCCGCGTGTGTGCCCT
ACTTGCGCAAGAATCTTAAATGGGTTGTTCAAAAGGGTGACGGCTCCATA
CCCATCAATACCCTCAAGAGCCTCAAAGTCGGTGTCTCCAGCTCGATCGT
CGAATA

Sequences in the Contig:

SY0AAB23YF11FM1