Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YE06FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00000296001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03305
Accession: ref|XP_001793875.1| Score: 916 E_value: 3e-97
KEGG Definition: DNA repair protein, SNF2 family [EC:3.6.1.-]; K01529
Accession: aor:AO090003000413 Score: 914 E_value: 2e-97
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0390 Score: 722 E_value: 2e-77
PFAM Definition: Helicase_C, Helicase conserved C-terminal domain. The Prosite family is restricted to DEAD/H helicases, whereas this domain family is found in a wide variety of helicases and helicase related proteins. It may be that this is not an autonomously folding unit, but an integral part of the helicase..
Pfam Number: pfam00271 Score: 190 E_value: 1e-15
Swissprot: P41410|RAD54_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle
GO:0005524 = Molecular function: ATP binding
GO:0007131 = Biological process: meiotic recombination
GO:0042148 = Biological process: strand invasion

Sequence:
>SY0AAB23YE06FM1
TTGGACGTTCCGAAAGACGCCCGAGGGAGAGACAGGGAGGTCAAAGTGTG
GTATTCCGGCAAGATGATGGTACTGGACAGGATGTTGGCAAGAATCCAGC
GCGAGACAAAGGATAAGATCGTCCTCATTAGCAATTATACACAAACACTA
GATGTATTTGAAAAGCTTTGTCGCTCAAGGGGTTACGGTGCCCTAAGACT
CGACGGTACAATGAACGGCTCAAAACGCACGAAGCTAGTCGCCAAGTTTA
ACGACCCTGATAGCGAAGAGTTTGTCTTCCTTCTCAGTAGCAAAGCCGGA
GGCTGCGGCATCAACCTTATCGGTGCGAACCGGCTCGTCCTCTTCGACCC
AGACTGGAACCCCGCCGCGGACCAGCAAGCTTTAGCGCGAGTCTGGCGTG
ATGGGCAAAAAAAGGATTGTTTCGTCTACCGCTTCATTGCCACAGGAACC
ATCGAAGAGAAAATCTTCCAGCGCCAATCGCACAAACAGTCGCTCTCCAC
GTCCGTCGTCGACGGCGTTGAAGACGTAGAAAGACATTTTGGTCTGGACG
GGCTGAAGCAGTTGTTCCGGTTCCAGCCAAATACTAATAGCGATACGCAT
GACACTTTCAAGT

Sequences in the Contig:

SY0AAB23YE06FM1