Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YC01FM1
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00010683001 E-value : 2e-96
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_12915
Accession: ref|XP_001803132.1| Score: 367 E_value: 4e-57
KEGG Definition: hypothetical protein
Accession: yli:YALI0B05368g Score: 326 E_value: 1e-53
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2387 Score: 374 E_value: 8e-37
PFAM Definition: CTP_synth_N, CTP synthase N-terminus. This family consists of the N-terminal region of the CTP synthase protein (EC:6.3.4.2). This family is found in conjunction with pfam00117 located in the C-terminal region of the protein. CTP synthase catalyses the synthesis of CTP from UTP by amination of the pyrimidine ring at the 4-position..
Pfam Number: pfam06418 Score: 359 E_value: 4e-35
Swissprot: O42644|PYRG_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAB23YC01FM1
TTGGCAACGACAAACTGGGTCTTGTCTCTCTTTTCCTTCCTTTCCTTTTG
AGAAAATTCTTACCAAATTTGAAACGAAGGTTGGAAAGATGAAGTACGTA
CTAGTTTCTGGAGGTGTGATTAGTGGGATTGGGAAGGGCGTTATTGCCTC
TTCGACGGGTCTATTGTTGAAGACCATTGGTCTTAAGATTTGTCTCCTCA
CTCCAGGTTTTATTGTATCCCTCTCGCTAAACCGTAGCTTTACGTCTCGG
CCATTAAGATCGATCCGTACATGAATGTCGATGCAGGAACTATGGCTCCC
ACCGAACACGGTGAGGTGTTTGTCCTCAATGATGGTGGTGAAGTCGACCT
GGACCTTGGCAATTACGAGAGGTACCTTAATATCACGCTTACTCGGGAGA
ATAATATCACTACCGGAAAGATTTATCAGCATGTCATTGAACGGGAGGTC
TGTTCTCCCTCTCAGCCATTAATGTTGCGGGCGAGTTTTTTTATTTTTTT
TTGTTAAAATTGGAGGAAAAATAGAGACGTGGTGATTACCTTGGGAAGAC
TGTCCAGGTCGTTCCTCACCTCACAGATGCCATCCAGGATTGGATCGAAC
GTGTGGCTCGCATTCCCGTCGACGAGACTTCTGAGGAGCCGGACACTTGT
ATAATAGAGTTGGGAGGGACTGTGGGAGATA

Sequences in the Contig:

SY0AAB23YC01FM1