Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YB19FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00004370001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: 3-hydroxyisobutyrate dehydrogenase
Accession: gb|EDP49675.1| Score: 416 E_value: 3e-39
KEGG Definition: 3-hydroxyisobutyrate dehydrogenase [EC:1.1.1.31]; K00020 3-hydroxyisobutyrate dehydrogenase
Accession: afm:AFUA_6G11020 Score: 410 E_value: 8e-39
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0409 Score: 322 E_value: 8e-31
PFAM Definition: NAD_binding_2, NAD binding domain of 6-phosphogluconate dehydrogenase. The NAD binding domain of 6-phosphogluconate dehydrogenase adopts a Rossman fold..
Pfam Number: pfam03446 Score: 369 E_value: 3e-36
Swissprot: Q99L13|3HIDH_MOUSE
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAB23YB19FM1
TTGGAGCTCAACCGATCTGGGATTGAGACTGCATACCTGGTACCTTAATC
ATGTTATTCCTACGGTCTCGCTACCTCTTGCCGTTCTCGAAAAGGCTCTT
TTCCACCTCTACTCGCCGTGATGCCACGTGGGGATTTGTTGGACTCGGGC
AAATGGGATACCCTATGGCTCGGAATCTACGTGTCAAGGCCTCCGCCGAC
GATATGCTTGTTATCTTCGATGTGAACAAGGATGCGACGACGCAGTTTGT
GGACGAATTAGGCTTGACGTCTAAGAAAATTGTTGTCGCGGGCAAGCTCG
AGGAGGTTGTGGATAGGAGTGACACAATTATAACTATGCTCCCTCAGCCA
CAGCATGTTAAAACTGTTTTTAGTTCTTTCCTTAATGTATCTTCTAGCCC
TGCTGGAAAGGAGCAAAAACTCTTCATCGATTGCTCGACAATCGACATAT
CTACCTCTCTTTCAGTCGGCAAGTCCGTGTGCGAGTCTGCTCTCAATGGA
CAGTTTGTCGATGCACCCGTATCCGGAGGAACTGTTGGAGCGGCTGCGGG
GACGTTAACCTTTATGGTTGGATCTGAGCCGGCACTCCTGCCCAGGATTA
TGTCTCTCCTTTCCCGCATGGGTAGTCGCGTTATCCATTGCGGACCGCCC
GGTGCCGGGTTGGCA

Sequences in the Contig:

SY0AAB23YB19FM1