Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YB02FM1
Length(NT) : 517
Best Gene Model Blast : Link to GSTUMT00002352001 E-value : 3e-85
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_07084
Accession: ref|XP_001554496.1| Score: 156 E_value: 2e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG01450.1 Score: 140 E_value: 9e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB23YB02FM1
TTGGGATCGTGTGCTCCTTCGCGACGACGGAGGACGCCATTAGTGTGCGC
CAGGTGCTGGATGGCGAGGCAATCATGGGAGACCGTGCACGTGTTTACTT
CGGCGAGCACACACCCGTACAACCGGTGGACCAGCACCTACAGGCGCCGG
AGTCGAAGAAGATGCCCGCCATATCCGTTGATGATTATACCGATTCCGGA
GACGAGGCGAGTCCTGTTTCGCCGGTGGCTCCGGTATCGCTACACACGGC
CAGACCACCCGTCGAGCTTATTCAGGACGCTTAGATTTACTTGCTTTCTT
TCCTTTCCCTTTTTTTTTTCTTTTGCTTGCATCAAATTTTTAATATGGAT
GGAGCGGTTGTGGGTTCTATAGTTAACTGAGGTGGATGGAAGGGCGTCTT
TCAGGTGTTTTAACTGATGTTTTGTCTTTTCTTTTCTTTTCTTTTCTCTT
TACGGGTGTCCGGGGGGGTGTACTCGGGGTGGGGGTGAAGTATTGGGACA
AGCAGGGGGCTTGATGT

Sequences in the Contig:

SY0AAB23YB02FM1