Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB23YA01FM1
Length(NT) : 515
Best Gene Model Blast : Link to GSTUMT00003602001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: NADH-ubiquinone oxidoreductase 49 kDa subunit, mitochondrial precursor
Accession: ref|XP_001540783.1| Score: 403 E_value: 5e-38
KEGG Definition: hypothetical protein
Accession: ang:An02g05470 Score: 402 E_value: 4e-38
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2870 Score: 358 E_value: 3e-35
PFAM Definition: No Hit Found
Swissprot: P22142|NDUS2_NEUCR
Gene Ontology:
GO:0008137 = Molecular function: NADH dehydrogenase (ubiquinone) activity

Sequence:
>SY0AAB23YA01FM1
TTGGCCCCCCCCCCTGTCTCAACCCCTCCACTCAATCCTCTCAATTGAGC
TCCTATACCTACCGACAGCAATGGCCTCAACTTTCGCCCGTCTGGCCGCC
AGGAGTTTAACCTGCGCAAGGCCTTTGGCTGTCTCCTCACCGATTCGCGC
CGCTCGTGCTATCCGGCCCTTTAAATCAACCCAGATATCCAGTGCAGAGG
CGGCGCCATACCAAAGAACCACTTTGACCGAGCTAGAGCCAAAAAATGAG
ACCACGGATGATTACTTGACGGAGGATCCTAATCATGACCCGGTGCATGG
CAGGAAAATGAGGCACTATACCGTCAATTTCGGTCCTCAACACCCGGCTG
CTCACGGTGTGCTGCGATTGATTCTTGAATTGAATGGGGAGGAGATCATT
CGTGCAGATCCTCATGTTGGACTTCTGCATAGAGGTACAGAAAAGTTGAT
TGAGTACAAGACGTATCTTCAGGCTTTGCCATACTTTGATCGTTTGGATT
ATGTTTCCATGATGA

Sequences in the Contig:

SY0AAB23YA01FM1