Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YP02FM1
Length(NT) : 528
Best Gene Model Blast : Link to GSTUMT00004192001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_05214
Accession: ref|XP_359563.1| Score: 234 E_value: 2e-18
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05214 Score: 234 E_value: 1e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB22YP02FM1
TTGGCGATGAACCAAACTCGATGAATTATCCAGAAGACCGGAGGGAGGTG
GTGCTCGGGGTGAATGCGGCGTGCTTGGGATGTACTATACTGTTCGTGGG
TTTGCGATCGTACGCGAGGTTTAGTGTGAAGGGTTTGGGTACGGATGATG
TGTTGATTTTCCTTGCCACATTGTGCAGTATCGGGTTATTTGTGACCTGC
CTTTTTGCAATGAAATATGGCATGGGAAGGCATGTCGGAACAATATCTTC
AGAGGAGTTGGTAGTGTACACCAAGATGACCTGGATCGGCGGATTAGTTC
ACACCGCATCAACAGCCTTTGTCAAGGCTTCACTACTGGCACTTTATCTG
CGCCTCTCACCCAGCAGAGCCTACCGAAGTCTGAGCTACATCTCGCTGGT
ATTAGTAGTTGGCCATGCGGTCTCAGGCCTTACGGTGACTACGTTTCAAT
GCACCCCAGTGCCGTACCTGTGGGACAAGACGATCAAGGGCCGCTGCATC
CGGACAGGAATTTTCCACTTTGTGAATG

Sequences in the Contig:

SY0AAB22YP02FM1