Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YO07FM1
Length(NT) : 688
Best Gene Model Blast : Link to GSTUMT00004833001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: high osmolarity signaling protein Sho1, putative
Accession: ref|XP_001259844.1| Score: 517 E_value: 7e-51
KEGG Definition: high osmolarity signaling protein Sho1, putative
Accession: afm:AFUA_5G08420 Score: 515 E_value: 6e-51
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0162 Score: 163 E_value: 2e-12
PFAM Definition: SH3_1, SH3 domain. SH3 (Src homology 3) domains are often indicative of a protein involved in signal transduction related to cytoskeletal organisation. First described in the Src cytoplasmic tyrosine kinase. The structure is a partly opened beta barrel..
Pfam Number: pfam00018 Score: 136 E_value: 3e-09
Swissprot: P40073|SSU81_YEAST
Gene Ontology:
GO:0043332 = Cellular component: mating projection tip
GO:0042802 = Molecular function: identical protein binding
GO:0005034 = Molecular function: osmosensor activity
GO:0007232 = Biological process: osmosensory signaling pathway via Sho1 osmosensor
GO:0007124 = Biological process: pseudohyphal growth

Sequence:
>SY0AAB22YO07FM1
TTGGATAATTTTGTCCATTGTTCAGATTATCTGGATATTCTATTTCGGAT
CCACTCCTGACGCTTCATCTCATGCGTATGTGGACTCGTTCGCTCTTCAC
AAAGATCAAAAGCGCTCGCAGAGTACGCGCCCCCTATCGCCCGCCTACCA
TGGAGGAGATAGACCCCACACTAGCACCAGCAGTCACCATGCTCCTCAGA
TGTACACCAGTGCACAACTCAACGGATTCGAAACGAGCTCGCCAGTACCT
GGTCAAGCTGGTCCAGATCACAGGCAGTCGGCAAACAGGCACGCATCTCC
TTCGGTTTCGACTCTGACACCCGGTCCATCTGCTACACCTCAGCCACAAA
GTCAAGGCGGACCACCAGATTCAGAAGTTTCGGCACCCACAGAATATCCA
TACAGAGCAAAAGCCATCTACTCCTACGACGCGAATCCAGAGGATGCGAA
TGAGATATCATTCGCAAAGCATGAGATACTGGAGGTGTCTGACGTTTCAG
GGCGATGGTGGCAGGCAAGGAAACAGAACGGTGAAACGGGTATCGCACCA
TCAAACTATTTGATTCTGTTGTAAAATTGAAAGATGAAAGGAGCGGGGTC
TTTTTTTTTTCTTCCTTTTTTGTCACATTCTACCCGTTACGTTTTCTTCT
TTCTATTTGTTTTGCTTTCCGGCGCTGGCGAGGTACTA

Sequences in the Contig:

SY0AAB22YO07FM1