Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YL14FM1
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00005858001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: KH domain protein
Accession: ref|XP_001275789.1| Score: 523 E_value: 1e-51
KEGG Definition: hypothetical protein
Accession: ang:An02g02410 Score: 522 E_value: 7e-52
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O74359|MUG60_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB22YL14FM1
TTGGATTGATCATGATCAGTATTACCTTTCGGACGGTGTGCCAAATACAC
GGATCACTGTTCATTTGGAGAGGATTGCTCAGTTTACGGGAACAGACATA
TTTGTCCTGAAGCCTCCGGAACCGACCTCGATCGTCGCGGTAGACCAGGG
CTCTGAGGCCAGCCAAAATAGGAGGCTGAAGATTAGTATTTTCGGGGACT
ATGAGAGTGTTGAGCATGCCAAGACTAGGGTTCTGATCATGATTGATGAT
TTGCTTGGACAAGAAGTCATCCCTACGTTCATGGAGCTGTCCGTTCAGAG
CATGATTTGCGGCCGCGGACGCAAAAATGTCAAATTGATCGAATCTGCCA
CAAGAACCGCCATCTACTTCCCCCCTCCGTTCCCCCAAGTATATGGGTAT
TCACCCCCGGGCGGCACCCGGCGCGATCCCGACCAGATATTCATCACCGG
CAGTTCCCGTGAGGATATTGCTAAGGCGGAGAGAATGCTTCTCAACCTGA
CTTTGGGCATGAGAATATTCGTCAAGGACGTTTCTATAACACTTACCAAG
ATTGATTATATCCTTCTTCAGAGATTAGACGATGTGAAGAAAATCATGGA
TGCAAATGGGACGTTTGT

Sequences in the Contig:

SY0AAB22YL14FM1