Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YL09FM1
Length(NT) : 675
Best Gene Model Blast : Link to GSTUMT00005609001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_08883
Accession: ref|XP_364038.1| Score: 336 E_value: 3e-32
KEGG Definition: hypothetical protein
Accession: mgr:MGG_08883 Score: 336 E_value: 1e-32
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB22YL09FM1
TTGGCAGGCCTCGAGAGAGAGTTTCAGCAGGGTGATGGCAAAGGCGTTAG
GGAAGAGAGAGGGAACGTAAGAGGTATCGGGCGCGAGAGGCAAGTTGAGA
GGAAACGTGAACTACTTGTCGGCACAATTCCCCGGGCCTTCGGCTCCTAG
AGATTTTGTAACCGCATGTCTGACATCCTCCGCAAGCCCAGAAGATCTAT
CGCAGCAGAGCCAACCCTACGATAGCCCCCCAACCAAGTCCCGGCAATTC
ACGATGGTATCGCGTCCACTGACTGACCATCCGGAGTGTGCCGAACGCCA
GGGATACGTGCGTGGACAATACGAATCGGTCGAATTCATCCGAGAGATTC
CCGCAGAACAGAATCTACGCATTAACCGTCGCGACGGGTCTGTTCTGCCC
GTGGTGAAGCGGGTTTGGAGCGTACCAAACCTGTTGGAGGATAAGGGGCG
AGTTGACCACGGGGGAAGAAAACGGGGACAGACGATCGCTTTCGCTGATG
GTGCTAAACCGGGAGATCGCGAAGAATACACACCCAGAGGCAGTATAGAT
AGCGCGAATATGCCGGTGGAAGACCCCGAAGAGAAACCCGTGGAATGGAT
TATGATCAGTCGTTCTGATCCCGGTGGAAGTGTTCCCAGGTGGATGGTAG
AGCGCGGCACCCCCGGATCTATTGT

Sequences in the Contig:

SY0AAB22YL09FM1