Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YH15FM1
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00011077001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213279.1| Score: 500 E_value: 1e-61
KEGG Definition: Zn-dependent hydrolase/oxidoreductase family protein, putative
Accession: afm:AFUA_3G13010 Score: 480 E_value: 4e-60
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3798 Score: 215 E_value: 2e-18
PFAM Definition: No Hit Found
Swissprot: Q769K2|NAPEP_RAT

Sequence:
>SY0AAB22YH15FM1
TTGGCCCTGTTGTGGACGCTGTGGTCATTAGTCATAATCATTATGACCAC
TTGGATCATAACACAGTTATAAAATTGAAGAAGCACCATCCAGATGCCTG
GTACTTCGTACCGTTGGGTAACAAGGCTTGGTTGGTTCGCCTGCTCCGGT
GTCGAGAAGTGTATCGAACTAGACTGGTGGGAGGAGCGAGATATTGTGCT
CACTCCATCCAATTCTCAGATCTCAGCCGGGTCTTCTCCCTCTACCGATC
CCAACGAACTATCATCGAAAGTGCAAGCGGAGCCCACAATGGAAGGTCCC
AAGGCGAATGGCATTGTTGCGAGAATAGGCTGCCTTCCATGCCAACATAC
CAGCAACAGAGGATTAACCGATCGAGGTGCGACATTGTGGGCCAGTTGGA
GTATAGAAAGCGGTGGAAAGAAGGTTTACTTTGGAGGCGACACCGGGTAC
CGTGCTGTCCCCCCGGACCTTCCGAAATCTGTTGATGATTACGGCGAAGA
GTTCAGAGACTTGCCAGTATGTCCGGCTTTCAAACAGATCGGGGAGCTGA
GAGGGCCGTTTGATGTTGGGCTGATACCCATTGGTGCCTACGTGCCAAGA
GGGTATGTTTCTTCCCACAATGCTTTCTTTTTTCCATTTTCATCTCAACT
GAAGGCTTTCCTTTTGCTCCCGCACTTGCTTTTATTTTATTCCTTTTTTT
ATTT

Sequences in the Contig:

SY0AAB22YH15FM1