Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YF17FM1
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00003365001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500831.1| Score: 219 E_value: 2e-16
KEGG Definition: hypothetical protein
Accession: yli:YALI0B13200g Score: 219 E_value: 1e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB22YF17FM1
TTGGTGATGACTCTGAGGAGAACCACAGCACCAAGTTACCACCTTTAAGA
GATGGACATGGCTCGGTTTTAACGAGTCATACTCAGCAAGGGCTCGAGAG
ACCTGTAGCTTTATACCCCCCGATGAATACTAGTGCTGTGAAACTCACTT
CTCGGCCGAGCGGTTGCCAACCCGGAGGCTGCGCGCAATGTCAGAACGAC
CCATTATCAACCCTGTTCTGTCAATCGGTGGCTACGAAAATGGATGGTGC
CGAAAAATCAGGGTGCTGTAGAGGAGGCTTATGTGGTGGTGATATTGGAG
GCTCAAGGCCAAGTGTTGGCGACAGCAAAGAGAAGGGAAAAGTCGATGAA
GGTGCCTCGGAGAAGGGAACGTTCATCCCCTGCAGTGCAGCATACCAGAC
ACTCTCCCGCCATCGCGCATTCGAGGATGCAACGACTGACCTGGGCAGTC
TTGTTCGTCCTCTAATGGTACGGAGTCTGGACGGAAGTTGCCCTCAGATT
GAGGTTTCAAGTATTCGGGAGGTACTCAGAAGGCTAGATAGAGGGTTTGG
CTCGGATGCGGGCAAGTATACGAAATAATGAATGGCTAGAATGGTTCCGG
GGCGCGGCGTATTCGGCTTTACTCTTATTCTTGCTTGGGGATTTTTTGTG
GATATTTATTATGATA

Sequences in the Contig:

SY0AAB22YF17FM1