Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YE08FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00003570001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: HECT domain protein
Accession: ref|XP_001260074.1| Score: 597 E_value: 3e-60
KEGG Definition: HECT domain protein
Accession: afm:AFUA_2G04450 Score: 587 E_value: 2e-59
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0941 Score: 480 E_value: 4e-49
PFAM Definition: HECT, HECT-domain (ubiquitin-transferase). The name HECT comes from Homologous to the E6-AP Carboxyl Terminus..
Pfam Number: pfam00632 Score: 509 E_value: 1e-52
Swissprot: Q05086|UBE3A_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0007420 = Biological process: brain development
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>SY0AAB22YE08FM1
TTGGCCCTGCGCTCGGACGAACAAGAGCCCAAAGAGGAGGCTCCCCTAGT
CACTAACGAGAACCGCGAGGCTTTCGTAAGGGATTACATATCCTGGCTAA
CTGACCGCTCCATCCGTCGACAATATCAAGCTTTCGAGAAAGGATTCTTT
GCCGTTATTGACCGAAAGTCTCTGTCCCTCTTTACACCCTCAAACTTCCA
ATCCCTAACAGAAGGCATCCAAGATATCGACATCTCAGAGCTCGAAAAGG
CCGCCCGCTACGAAGATGGCTATAGTCCAACCCACCGTGTAATCAAGGAC
TTCTGGGCGATCGTGCGCGGCTTCTCTGCCGAGCGGCGCCGCCAACTCCT
GGAATTCGTCACGGCCAGCGGACGCGTGCCCGTCAACGGGATTTCCAGCA
TCATGTTTGTGATTCAGAGGAATGGGCCGGACAGCGATCGTGTACCCACT
AGTCTTACGTGCTTTGGGAGACTGCTGTTGCCGGAGTATTCGCGGCGTGC
AAAGTTGAGGGATAAGTTGAAGCTTGCCTTGGAAAATGGGAAGGGGTTTG
GGGTTCCTTGAGAGGTTGTTTATCTCTTGTTCCAGCCCTTTTCTCTCTTC
CTTTTCTGCTCGTCCATCGGATGGTGGGGGCTGGCTGGCTGGTGGCGGGG
TTTTCTTTGCTGTTTGTC

Sequences in the Contig:

SY0AAB22YE08FM1