Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YE01FM1
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00012119001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein HCAG_04679
Accession: ref|XP_001540839.1| Score: 517 E_value: 6e-51
KEGG Definition: SIR2 family histone deacetylase, putative
Accession: afm:AFUA_5G04120 Score: 492 E_value: 2e-48
KOG Definition:
Classification: [Chromatin structure and dynamics, Transcription].
Kog Number: KOG2683 Score: 362 E_value: 2e-35
PFAM Definition: SIR2, Sir2 family. This region is characteristic of Silent information regulator 2 (Sir2) proteins, or sirtuins. These are protein deacetylases that depend on nicotine adenine dinucleotide (NAD). They are found in many subcellular locations, including the nucleus, cytoplasm and mitochondria. Eukaryotic forms play in important role in the regulation of transcriptional repression. Moreover, they are involved in microtubule organisation and DNA damage repair processes..
Pfam Number: pfam02146 Score: 221 E_value: 4e-19
Swissprot: Q9RL35|NPD1_STRCO

Sequence:
>SY0AAB22YE01FM1
TTGGCAATAAGGTCTCCCATGAGACTCGCAATAGTGAAATATATCCCTTT
CTCCCATGGTAACCCCTCGAATTCCATACGTCCTGCCATTCCCACCGCCC
CCAATTCACCCCAAAAACGCCACGACACTCTCCGCAGCAATCGATGCAGT
GACCAACTTTCTGGAGTCGCGCGACGTCGTCATCCTTACGGGCGCTGGTA
TTTCTGTCGAGAGCGGCCTGGCAGACTACCGTGGCGAGAAGGGAACCTAC
AGACTGAACCGGACTTACCGGCCAATATTCTATGAGGAATTTGCGGGGAA
TCATGAAGCCCGGAAACGATACTGGACGCGAAGTTTCCTCGGGTGGCCGA
CAATGGAAAAAGCCCAGCCGAATAGAGTGCACAGGTCGATTTCGATACTA
GGAAAGCTGGGGGTGCTGAATCACGTAATCACTCAAAACGTTGATTCCCT
CCACCACACCTGTCACCCCCACTTGCGAACTACGGAACTACATGGCACTC
TCCAAACACTCATCTGTCTAACCTGCCGCTCCCCATACCCGCGCGTTGAA
TTTCAGAAAACCCTCGCAGAGTTAAACCCCAAATGGGCGGAATTTCTACA
CATTGCTACAGAAGCTGGAATGTTCGGCAATG

Sequences in the Contig:

SY0AAB22YE01FM1