Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB22YA02FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00000719001 E-value : 1e-178
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CC1G_04030
Accession: gb|EAU90761.1| Score: 294 E_value: 6e-34
KEGG Definition: deoC; deoxyribose-phosphate aldolase [EC:4.1.2.4]; K01619 deoxyribose-phosphate aldolase
Accession: mxa:MXAN_5719 Score: 209 E_value: 8e-32
KOG Definition: No Hit Found
PFAM Definition: DeoC, DeoC/LacD family aldolase. This family includes diverse aldolase enzymes. This family includes the enzyme deoxyribose-phosphate aldolase EC:4.1.2.4, which is involved in nucleotide metabolism. The family also includes a group of related bacterial proteins of unknown function. The family also includes tagatose 1,6-diphosphate aldolase (EC:4.1.2.40) is part of the tagatose-6-phosphate pathway of galactose-6-phosphate degradation..
Pfam Number: pfam01791 Score: 135 E_value: 3e-09
Swissprot: Q6ALS3|DEOC_DESPS
Gene Ontology:
GO:0004139 = Molecular function: deoxyribose-phosphate aldolase activity
GO:0016052 = Biological process: carbohydrate catabolic process

Sequence:
>SY0AAB22YA02FM1
TTGGGGAAAACGCGGCTCCACCTTTGTCTCAGGTCTTTTCCATCTACGAT
ATCGGTACTTTATCTTAGGATGCGGTCGAACGAAGACTGGAAAATCGCCG
TCAAGGCAAAGATAGATGAAGTCTTGGCCAATGCAACAGCCGCAGAATAC
CCTCCGCCAGCGTCTCTACCGGCCACTATTGATCACACACTATTGAAGCC
CGATGCAACCCCAGCCCAAATCAATACATTGTGCGATGAAGCCATCAAAT
ATGGGTTCAAATCGTGTTGTGTTAATGGATCCTATATCCCTCAGGTTGCC
GAAAGGCTACAAGGGACTCGGGCAATTCCGTGCGTAGTAGTGGGCTTCCC
GCTGGGTGCGATGAAGCCAAGCGCCAAAGCATTGTGAGTTCTTTCTCCGA
AGCCGTATCAAGCAAATAGATGAGTGAACGGCACCTCAAAATAAAAGAGG
GCACGAACGGTAATAAGTTCCCCTCTGAGATCTCCAGTGAAGCGCAGGAA
GCCGTACGAGATGGTGCGAAGGAAGTGGACATGGTTCTACATATTGGTCA
CTTGAAATCCCAAGACTACGTCTGTCTGCACGCAGATGTAGAAGCCGTCG
TTAGAGCGTGTTCACCGATCCCCGTTAAGGTTATCCTCGAGACAGTATTT
CTCACCGATGAAGAGAAG

Sequences in the Contig:

SY0AAB22YA02FM1