Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB21YO22FM1
Length(NT) : 726
Best Gene Model Blast : Link to GSTUMT00007296001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_03220
Accession: ref|XP_001558188.1| Score: 192 E_value: 2e-22
KEGG Definition: hypothetical protein
Accession: ani:AN4006.2 Score: 244 E_value: 2e-19
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1238 Score: 132 E_value: 9e-09
PFAM Definition: GMC_oxred_C, GMC oxidoreductase. This domain found associated with pfam00732..
Pfam Number: pfam05199 Score: 118 E_value: 4e-07

Sequence:
>SY0AAB21YO22FM1
TTGGCTTCACACTCCGCAGATATTACAACTCTCGGGAATCGGACAAAAGA
GTCTCCTGGAGAAACTTGGTATCCCAGTATTAATAGATTTGCCTGGCGTG
TAAGCTGCTCCGCACTTTAGTGCTAGGTTCAGAGTATGCTGAAAACAGAC
CGAGCGCCCAGCGGACAGAACCTCCAGGATCACCCATAGCAGTTGGTACT
ATGTCTCTAAAGCTGGACAACGTTGAACACTCAGTTATTGATCTCGAGAA
AAATGCAACTTGGGATGCGGAGTCTAAAGATCTCTTCTATAAAGCCCGTG
AAGGCCCATGGACAGCCGGAAGCCCCAACTCAGTAGCTTTCCTCCCCCTG
TCCACCTACACCAACCAATCCGAGACCCTGCTAGGCGCCTACACAACCCA
AGCGCCAGGCCAGTACCTCCGCAATGATTACGACCCAGTGATAACAGCCA
GTTTTCAAAAACACCGCCAAATCCTCCTAAACAGGCTCGCGGGCACGCAC
ACAGCTGCAATGGAGTATATGTGGCTCAGCGGTGCCAACCGGTTCTTCCA
AATGCCCTTCTCCATCTCCATCACTCACCCCTTCAGCCGTGGCTTCATAG
AAATCAACTCGACGGATCCCCTTGCCGCCCCGATCGTGGACCTGCGCACG
GGGAGCAACCCAGTCGATCTCAACCTCTTCATTGAAGCGTTCCGTTTCTG
CCGCCGCGTTGTGCAGACTCGAGCGA

Sequences in the Contig:

SY0AAB21YO22FM1