Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB21YK21FM1
Length(NT) : 679
Best Gene Model Blast : Link to GSTUMT00009187001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_15267
Accession: ref|XP_001805424.1| Score: 506 E_value: 1e-49
KEGG Definition: DNA repair protein Pso2/Snm1, putative
Accession: afm:AFUA_2G15220 Score: 492 E_value: 3e-48
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1361 Score: 337 E_value: 2e-32
PFAM Definition: No Hit Found
Swissprot: Q10264|PSO2_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0006281 = Biological process: DNA repair

Sequence:
>SY0AAB21YK21FM1
TTGGGTACGTGCAGGAATTCCCATTTGAAGAGTGGACGGATGTGGTTGAT
GGGATTCGTGTGAGAGGGTTGGATGCGAACCATTGTCCGGGAAGCATGCT
ATTCTTATTCGAGCAAGACTGTGTCGGAAGGCTGGGCAAGCAGAGAATTC
TCCATTGCGGCGATTTCAGAGCTTCGGCAAAGCATCTGAATCATCCTCTG
TTGAGACCGGGAAAAGACGGCGTTAAGGGACAAAAACTGGATTCGGTATA
CCTGGACACCACATACCTTAATCCGAAATATGCATTCCCTAGTCAAAAGA
GTGTTATCAAAGCTTGCGAGGAGCTTTGTGTGGGACTTAATAAAGAATCA
ATTGATGGTCAAGGAGGGACGTTCGCGAAAACAGCAACTCTGATGAATAG
GATGGGAAAATTCGTACAAGGTAGCAAAGTCGGTGGTAAGGGGAAAGGGA
AGCTCCTCGTTGTTGTGGGGACCTATAGTATCGGAAAAGAGAAAGTCTGT
TTAGGAATTGCAAAAGCTCTTTGCTCCAAAATCTTCGCACCACAAGATAA
GATCAAAATTTGCCAGTGTCTTGAGGACGAAGAGCTTAATTCGAGATTGA
CCAGTGATCCGAACGAAGCCCAGGTCCACATGACACCGCTAATGAAAATT
AACCCCGAGACTCTGCGAGACTACCTCAA

Sequences in the Contig:

SY0AAB21YK21FM1