Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB21YJ16FM1
Length(NT) : 721
Best Gene Model Blast : Link to GSTUMT00009404001 E-value : 6e-47
Numbers of ESTs : 1

Blast Results:

Nr Definition: PREDICTED: similar to polyprotein
Accession: ref|XP_001198299.1| Score: 168 E_value: 2e-10
KEGG Definition: LOC762606; similar to polyprotein
Accession: spu:762606 Score: 168 E_value: 1e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB21YJ16FM1
TTGGCCAAAAACGGTGGATATCACATGAAGCAATAAAGGATCTTACCTGG
TGGTCTGAGCTGCTGGCTCACATACCCGAGAGGTCTATACTGACCTGAGA
GAGGAACCGAGTCTTTACCTGGTCCGATGCAGCTGGTACGAAGGGACTTG
GCGGTTACTACCTTAACGATGGCGAGACACTTCCACTACCCTCCTCCGCC
TTCTCTATAGCGCTGCCAAGGCACCTGGCCAGATCCCGAGAGCATATCAA
CACTCAGGAGATGTGGGCCGTAGAGCAATTACTTTTGTACTGGGGGCAAG
AATGGAAGGGAAAGAAGGTGGTGATGTATGTAGACAATCAAGCAGTGGCC
TACGGAATCGAAAACTGAACCATTAGAGGGGGCTCAATGACAGTTCTGCG
GAGGTGCTTGCTACTCGCAGTAGAATACGACCTCGAGCTAGAAACGCGAT
GGATACCAACCACAGAGAATGATCTCGCTGATGCACTCTCACGTTTTGAC
TTTGAGAAAATAACTGACATAGCACCCTAGTTAGTATAGCCAATATCCAA
CCTCCAGAAATACGGTTGTCGCATCTACGGCAATTGGGGCTCTCCAGAGT
AGCCGCTTATTATCTCTGGCGGGGGCTTGCGCCCAATACAAGGCGAAACT
ACGGTACACTACATTCCCACTTTACTCTTTTTTGTGCCCTTTCTGACTTC
CGCCACAATAACGGTGGCTGC

Sequences in the Contig:

SY0AAB21YJ16FM1