Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB21YJ04FM1
Length(NT) : 692
Best Gene Model Blast : Link to GSTUMT00005852001 E-value : 1e-111
Numbers of ESTs : 1

Blast Results:

Nr Definition: Mitogen-activated protein kinase HOG1 (MAP kinase HOG1)
Accession: sp|Q0U4L8|HOG1_PHANO Score: 328 E_value: 3e-45
KEGG Definition: hypothetical protein
Accession: ang:An08g05850 Score: 326 E_value: 2e-45
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0660 Score: 249 E_value: 2e-22
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 138 E_value: 2e-09
Swissprot: Q0U4L8|HOG1_PHANO

Sequence:
>SY0AAB21YJ04FM1
TTGGCTCTCTTTTCTCCTCGCCTCCCCCTTATACTTTTTTCCACCTTTTC
TTCCCCTTTGAAATAGTAGAGCCGTACCTTGAGAGCGCGTTGAAGAATAT
TATTTTCAACCCCACTTCCGTTATCGAATTCATCCTCTCAGCAACATTTT
GTTTGCCACACGGGACCTACTCGGGATTGTACCGTACTTATCCGACGAAA
CGAAGCGAAACGGCCTGTGTTCTGTTTACTACCCACTTGGACCGCTTCAA
CCTCCCCACCCTTCTCTTCCACCTCACCCCGCCACTCGTCCATCATCCCA
GGAACAACACAGCAACAGTTCCTTGGATTACCTCGACCCTAGGCCCTTCT
ACCTAGTATTTAGCTATACTCTTCCGAACCTTTCGACATGGCTGAATTCG
TCCGCGCTCAGATCTTTGGAACAACTTTCGAGATTACAAGCAGATACACT
GATCTGCAACCCGTGGGCATGGGTGCCTTTGGTCTCGTCTGTCCGTCGCT
ATAAAGAAGATCATGAAGCCCTTCAGCACGCCGGTTTTGTCCAAGAGAAC
TTACCGTGAGCTGAAACTGCTCAAGCACTTGCGGCATGAGAATGTCATTA
GTCTTAGCGATATCTTCATATCTCCTCTGGAGGACATTTACTTCGTCACT
GAGCTTCTTGGTACTGATCTGCACCGATTATTAACCTCTCGG

Sequences in the Contig:

SY0AAB21YJ04FM1